scholarly journals Characterization and Sap Transmission of Citrus Bent Leaf Viroid in Malaysia

2019 ◽  
Author(s):  
Yasir Iftikhar ◽  
Ying Wei Khoo ◽  
Taneswari Murugan ◽  
Nur Athirah Roslin ◽  
Rabiatul Adawiyah ◽  
...  

AbstractA 328 nucleotide (nt) variant of Citrus bent leaf viroid (CBLVd) was characterized from citrus varieties in Malaysia showing leaf bending, stunting and midvein necrosis. CBLVd was detected by RT-PCR assay using CBLVd specific primers in 12 out of 90 samples, collected from six different areas in Malaysia. The viroid was present in five species of citrus namely Citrofortunella microcarpa, Citrus aurantifolia, C. hystrix, C. maxima and C. sinensis. Sequence analysis of the isolates obtained from this study showed 99-100% sequence identity to CBLVd Jp isolate (AB006734). Inoculation of sap obtained from a CBLVd positive C. aurantifolia, inoculated into six months old C. microcarpa seedlings showed the symptoms leaf bending, reduced leaf size of matured leaves and mild mosaic between 4 to 6 months after inoculation. The presence of CBLVd in the inoculated seedlings were confirmed by RT-PCR assay and sequencing.Author SummaryThe authors during a limited survey collected the citrus samples from citrus growing areas of Malaysia to detect the citrus viroids. Citrus viroids are associated with decline in citrus production. Thus, the presence of the citrus viroids and their spread needs to be investigated to facilitate the management of this pathogen in citrus orchards. The authors detected and characterized Citrus bent leaf viroid in Malaysian citrus.

2021 ◽  
Vol 39 (2) ◽  
pp. 159-163
Author(s):  
Faheema Bakhtawar ◽  
◽  
Yasir Iftikhar ◽  
Muhammad Ahmed Zeshan ◽  
Muhammad Imran Hamid ◽  
...  

A study was conducted to monitor the Citrus bent leaf viroid (CBLVd) in citrus growing areas of district Sargodha, Pakistan during 2017-2018. Collected samples were tested by RT-PCR using specific primers. PCR positive samples were used to confirm the CBLVd incidence and severity on different citrus varieties grown at different regions of Sargodha. Maximum disease incidence was recorded in Kot Momin with the mean value of 24%, with severe symptoms of bark cracking, backward leaf bent and stunting. Minimum disease incidence was recorded in in Sillanwali region with the mean value of 3.33%. The symptoms in Sillanwali were only yellowing and slight leaf bent. Maximum severity was observed in Kot momin (0.60%). Molecular detection of CBLVd by RT-PCR confirmed the diagnosis of the viroid. This survey was carried out for the first time in Sargodha district to monitor the occurrence of citrus bent leaf viroid following the first report of its detection in Pakistan in 2009. Since many declining citrus trees were found negative to CBLVd testing, other causal agents can be involved, and extensive surveys are still required in the near future. Keywords: Citrus, RT-PCR, CBLVd, Disease incidence, viroid, Sargodha, Pakistan


Plant Disease ◽  
1997 ◽  
Vol 81 (9) ◽  
pp. 1023-1026 ◽  
Author(s):  
R. J. Schnell ◽  
D. N. Kuhn ◽  
C. M. Ronning ◽  
D. Harkins

A method for the routine detection of avocado sunblotch viroid (ASBVd) in nucleic acid extracts of infected avocado tissues by reverse transcription-polymerase chain reaction (RT-PCR) was developed using ASBVd-specific primers. Amplified cDNA products were analyzed by electrophoresis on nondenaturing 6% polyacrylamide slab gels. The size of the major RT-PCR product from ASBVd-infected tissue was estimated to be 250 bp. This product was absent from amplified extracts of uninfected tissue. The amplification product from ASBVd was sequenced by the dideoxynucleotide chain termination method, and the sequence was over 97% identical to the published sequence. The RT-PCR assay is sensitive enough to allow viroid detection without requiring large amounts of tissue, highly purified ASBVd, or molecular hybridization.


Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 970-970 ◽  
Author(s):  
R. M. Castro ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez ◽  
R. W. Hammond

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.


Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
T. Tornos ◽  
M. C. Cebrián ◽  
M. I. Font

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.


Plant Disease ◽  
2021 ◽  
Author(s):  
Xiaohui Sun ◽  
Ning Qiao ◽  
Xianping Zhang ◽  
Lianyi Zang ◽  
Dan Zhao ◽  
...  

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.


Plant Disease ◽  
2005 ◽  
Vol 89 (11) ◽  
pp. 1243-1243 ◽  
Author(s):  
A. Dalmon ◽  
S. Bouyer ◽  
M. Cailly ◽  
M. Girard ◽  
H. Lecoq ◽  
...  

Since 2002, yellowing symptoms associated with high levels of white-fly populations have been observed in plants of protected tomato crops in France. Symptomatic plants exhibited interveinal yellowing areas in older leaves, followed by generalized yellowing. Symptoms were not observed in young plants or fruits. Trialeurodes vaporariorum populations were generally abundant in spring, and Bemisia tabaci (established in France for approximately 10 years) became predominant in summer and fall. To check for the presence of Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), two whitefly-transmitted criniviruses known to induce yellowing symptoms, 696 samples were collected in the major tomato-growing areas; 573 samples from southern France and 123 samples from northern France. Total RNA was extracted from each sample and analyzed using reverse transcription-polymerase chain reaction (RT-PCR). Primers specific to ToCV (2) and TICV (1,3) were used to amplify either part of the heat-shock-like protein gene HSP70h (both viruses) or part of the diverged coat protein gene (CPd), (TICV only). A 439-bp DNA fragment was obtained with ToCV primers in 178 samples from southern France collected mainly from mid-spring to early fall from 2002 to 2004. Three RT-PCR products amplified from samples collected from diverse growing areas were sequenced and showed 99 to 100% sequence identity with published ToCV sequences from Spain (GenBank Accession Nos. AF215818, AF233435, and AF215817), Portugal (GenBank Accession No. AF234029), Sicily (GenBank Accession No. AY048854), and the United States (GenBank Accession No. AF024630). Considering the high frequency of ToCV-infected samples (41 positive samples of 112 samples collected in 2002, 71 of 295 collected in 2003, and 66 of 166 collected in 2004), this virus appears to be well established in southern France but remains absent in the northern regions. The presence of TICV was tested in 485 samples using the CPd-specific primers or the HSP70h-specific primers. The virus was detected in only two samples from Nice (southeastern France) in 2003 with both primer pairs. The CPd DNA fragment (700 bp) from one of these samples was sequenced, showing 98.9% sequence identity with a TICV Japanese isolate (AB085603). Results of these assays suggest that in contrast to ToCV, TICV is not yet broadly established in France. This difference could be associated with the specificity of the vectors, since ToCV is transmitted by B. tabaci and T. vaporariorum, while TICV is transmitted only by T. vaporariorum (4). References: (1) R. H. Li et al. Plant Dis. 82:84, 1998. (2) D. Louro et al. Eur. J. Plant Pathol. 1065:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002. (4) G. C. Wisler et al. Plant Dis. 82:271, 1998.


Plant Disease ◽  
2021 ◽  
Author(s):  
Ashwini Kumar ◽  
Bichhinna Maitri Rout ◽  
Shakshi Choudhary ◽  
Amish K. Sureja ◽  
V. K. Baranwal ◽  
...  

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.


Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1230-1230 ◽  
Author(s):  
M. E. Gratsia ◽  
P. E. Kyriakopoulou ◽  
A. E. Voloudakis ◽  
C. Fasseas ◽  
I. E. Tzanetakis

Uncommon, viruslike symptoms (yellowing, line patterns, leaf deformation, and necrosis), were observed in spinach fields in the Marathon area, Greece in 2004. Seedlings from the same seed lot, grown in the greenhouse, also developed the same viruslike symptoms, indicating that the causal agent(s) of the disorder is seed-transmissible. Spinach seedlings of the same variety but a different lot and herbaceous indicators (Chenopodium quinoa, C. amaranticolor, Sonchus oleraceus, and Nicotiana benthamiana) were mechanically inoculated with infected material. Spinach developed yellowing or necrotic spots whereas indicators showed variety of symptoms including mosaic, vein banding, and necrotic lesions. Virus purifications, double-stranded RNA extractions, cloning, and sequencing (2,3) followed by a combination of molecular (reverse transcription [RT]-PCR and immunocapture RT-PCR) and serological (ELISA) techniques with antisera provided by Dr. Avgelis were performed as described (4), verifying the presence of two viruses in the diseased seedlings: Sowbane mosaic virus (SoMV), a sobemovirus, was present in spinach and indicators with mottling and leaf deformation, whereas Olive mild mosaic virus (OMMV), a necrovirus, was present in plants with necrotic spots. All RT-PCR products amplified with primers SoMV-F (5′-CAAATGGTCTTGGTCAGCAGTC)/SoMV-R (5′-GCATACGCTCGACGATCTG) and OMMV-F (5′-CAAACCCAGCCTGTGTTCGATG)/OMMV-R (5′-CATCAGTTTGGTAATCCATTGA) were sequenced and found to confirm the other results. The SoMV-spinach isolate polyprotein gene sequence (GenBank Accession No. DQ450973) has 95% sequence identity with the type isolate from C. quinoa (GenBank Accession No. GQ845002), whereas the OMMV-spinach isolate (GenBank Accession No. JQ288895) has 92% sequence identity with the OMMV type isolate from olive (GenBank Accession No. AY616760). SoMV has been found to naturally infect spinach in the Netherlands (1) and, to our knowledge, this is the first report on spinach in Greece. The presence of OMMV in spinach is, to our knowledge, the first report worldwide. Its natural host range is limited to olive, tulip, and now spinach. OMMV might be transmitted by Olpidium spp. and may, according to data of its close relatives, persist in the soil for several decades. Pollen- and seedborne viruses (PSVs) like sobemoviruses and necroviruses are of particular importance for a crop like spinach where crop increase takes place in small, seed production-designated areas. If a PSV spreads in such an area it has the potential to become a major problem for the industry, especially when it remains undetected. Infected seed can be shipped worldwide with PSVs, causing diseases and becoming endemic in areas where they were absent. For this reason and the fact that field losses can exceed 50%, rigorous monitoring for the presence of SoMV and OMMV in seed fields is essential to minimize the possibility of the viruses moving to new areas. References: (1) L. Bos and N. Huijberts. Eur. J. Plant Pathol. 102:707, 1996. (2) S. M. Girgis et al., Eur. J. Plant Pathol. 125:203, 2009, (3) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005. (4) I. E. Tzanetakis et al. Virus Res. 121:199, 2006.


2008 ◽  
Vol 124 (1) ◽  
pp. 175-180 ◽  
Author(s):  
Xuefeng Wang ◽  
Changyong Zhou ◽  
Kezhi Tang ◽  
Yan Zhou ◽  
Zhongan Li

2013 ◽  
Vol 7 (11) ◽  
pp. 892-896 ◽  
Author(s):  
Shamsun Nahar ◽  
Mokibul Hassan Afrad ◽  
Noorjahan Begum ◽  
Feroz Al-Mamun ◽  
Azadul Kabir Sarker ◽  
...  

Introduction: Norovirus is not usually investigated in diarrheal patients in Bangladesh which may account for the many cases where no pathogens are identified. Methodology: Stool specimens collected from diarrheal patients from three hospitals in Bangladesh during 2011 were investigated for norovirus RNA using real-time RT-PCR assay with norovirus type specific primers and probes. Results: Of the 257 stool specimens tested, 28.4 % were norovirus positive. GII (71.2%) was the predominant strain followed by GI (20.5%), GI+GII (6.8%) and GIV (1.4%). Half of the norovirus positive stools (n=37) were co-infected with other pathogens. Conclusion: Continued surveillance of norovirus together with other viral and bacterial pathogens in hospitalized gastroenteritis patients as well as in the community will further elucidate the role and burden of different pathogens in diarrheal diseases.


Sign in / Sign up

Export Citation Format

Share Document