scholarly journals Quantitative mitochondrial DNA copy number determination using droplet digital PCR with single cell resolution: a focus on aging and cancer

2019 ◽  
Author(s):  
Ryan O’Hara ◽  
Enzo Tedone ◽  
Andrew Ludlow ◽  
Ejun Huang ◽  
Beatrice Arosio ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
T Cell Activation ◽  
Copy Number ◽  
Metabolic Regulation ◽  
Single Cells ◽  
Digital Pcr ◽  
Droplet Digital Pcr ◽  
Mtdna Copy Number ◽  
Mitochondrial Dna Copy Number ◽  
Human T Cell

ABSTRACTMitochondria are involved in a number of diverse cellular functions, including energy production, metabolic regulation, apoptosis, calcium homeostasis, cell proliferation and motility as well as free radical generation. Mitochondrial DNA (mtDNA) is present at hundreds to thousands of copies per cell in a tissue-specific manner. Importantly, mtDNA copy number also varies during aging and disease progression and therefore might be considered as a biomarker that mirrors alterations within the human body. Here we present a new quantitative, highly sensitive droplet digital PCR (ddPCR) method (ddMDM; droplet digital mitochondrial DNA measurement) to measure mtDNA copy number not only from cell populations but also from single cells. Our developed assay can generate data in as little as 3 hours, is optimized for 96-well plates and also allows the direct use of cell lysates without the need for DNA purification or nuclear reference genes. Importantly, we show that ddMDM is able to detect differences between samples whose mtDNA copy number was close enough as to be indistinguishable by other commonly used mtDNA quantitation methods. By utilizing ddMDM, we show quantitative changes in mtDNA content per cell across a wide variety of physiological contexts including cancer progression, cell cycle progression, human T cell activation, and human aging.

scholarly journals Quantitative mitochondrial DNA copy number determination using droplet digital PCR with single-cell resolution

2019 ◽  
Vol 29 (11) ◽  
pp. 1878-1888 ◽  
Author(s):  
Ryan O'Hara ◽  
Enzo Tedone ◽  
Andrew Ludlow ◽  
Ejun Huang ◽  
Beatrice Arosio ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Single Cell ◽  
Copy Number ◽  
Digital Pcr ◽  
Droplet Digital Pcr ◽  
Dna Copy Number ◽  
Copy Number Determination ◽  
Mitochondrial Dna Copy Number

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

2021 ◽  
Vol 33 (2) ◽  
pp. 123
Author(s):  
E. J. Gutierrez ◽  
F. B. Diaz ◽  
K. R. Bondioli
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Pure Water ◽  
Digital Pcr ◽  
Control Group ◽  
Atp Content ◽  
Mtdna Copy Number ◽  
Atp Production ◽  
Mitochondrial Dna Copy Number ◽  
Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

264 MITOCHONDRIAL DNA COPY NUMBER IN OOCYTES OF PREPUBERTAL AND CYCLIC GILTS

2011 ◽  
Vol 23 (1) ◽  
pp. 230
Author(s):  
P. Pawlak ◽  
E. Pers-Kamczyc ◽  
D. Lechniak-Cieslak
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Blastocyst Stage ◽  
Developmental Competence ◽  
Published Data ◽  
Mtdna Copy Number ◽  
Final Size ◽  
Domestic Species ◽  
Mitochondrial Dna Copy Number ◽  
Wide Range

In many domestic species (pig, cow, sheep), oocytes from prepubertal females show impaired quality when compared with those from adult animals. Incomplete cytoplasmic maturation is thought to be the main factor responsible for reduced developmental competence of embryos derived from prepubertal oocytes. The status of ooplasm maturation is also reflected by the copy number of mitochondrial DNA (mtDNA). Because replication of mtDNA ceases when oocytes reach their final size and occurs again at the blastocyst stage, the mtDNA copy number is a proved marker of oocyte quality in the pig (El Shourbagy et al. 2006 Reproduction 131, 233–245). The number of mtDNA copies in the grown oocyte is crucial to sustain the first embryonic divisions. To increase the rate of good-quality blastocysts, oocytes of domestic animals have been evaluated by the brilliant cresyl blue test (BCB). According to El Shourbagy et al. (2006), more competent BCB+ oocytes possess higher copy number of mtDNA (on average 222 446) than do their BCB– counterparts (115 352). However, there are no published data on the variation in mtDNA copy number in oocytes derived from ovaries of prepubertal (NCL) and cyclic (CL) gilts. Ovaries of NCL and CL gilts were collected in a local slaughterhouse. Cumulus–oocyte complexes (COC) were aspirated from nonatretic follicles 2 to 6 mm in diameter and evaluated morphologically. Only COC with a proper morphology were subjected to the BCB test. A group of non-BCB-treated COC served as control. Four groups of COC were collected: BCB+ (CL, NCL) and control (CL, NCL). Follicular cells attached to oocytes were removed by pipetting, and completely denuded gametes were individually frozen in liquid nitrogen. Analysis of the mtDNA copy number included isolation of the total DNA followed by amplification of the Cytochrome b (CYTB) gene by real-time PCR (one copy per one mitochondrial genome). Differences in mtDNA copy number among experimental groups were evaluated by Student’s t-test. To date, 30 BCB+ oocytes have been analysed individually (15 CL and 15 NCL). The analysed parameter varied in a wide range from 79 852 to 522 712 copies in CL oocytes and from 52 270 to 287 852 copies in NCL oocytes. Oocytes from cyclic gilts contained significantly more mtDNA copies (on average 267 524) than did gametes of prepubertal females (179 339; P < 0.05). The data on the mtDNA copy number in the control oocytes are currently under investigation. The preliminary results indicate that impaired oocytes quality of prepubertal gilts may be also attributed to the reduced copy number of mtDNA. This project was sponsored by MSHE Poland (grant no. 451/N-COST/2009/0).

scholarly journals Social integration predicts mitochondrial DNA copy number in rhesus macaques

2018 ◽  
Author(s):  
Reena Debray ◽  
Noah Snyder-Mackler ◽  
Jordan Kohn ◽  
Mark Wilson ◽  
Luis Barreiro ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Social Stress ◽  
Copy Number ◽  
Rhesus Macaques ◽  
Dominance Rank ◽  
Low Rank ◽  
Mtdna Copy Number ◽  
Dna Copy Number ◽  
Chronic Social Stress ◽  
Mitochondrial Dna Copy Number

AbstractIn many social mammals, social adversity predicts compromised health and reduced fitness. These effects are thought to be driven in part by chronic social stress, but their molecular underpinnings are not well understood. Recent work suggests that chronic stress can affect mitochondrial copy number, heteroplasmy rates, and function. Here, we tested the first two possibilities, for the first time in nonhuman primates. We manipulated dominance rank in captive female rhesus macaques (n=45), where low rank induces chronic social stress, and measured mitochondrial DNA copy number and heteroplasmy in five peripheral blood mononuclear cell types from each study subject. We found no effect of dominance rank on either mtDNA copy number or heteroplasmy rates. However, grooming rates, a measure of affiliative social behavior predicted by high social status, was positively associated with mtDNA copy number in B cells, cytotoxic T cells, and monocytes. Our results suggest that social interactions can influence mtDNA regulation in immune cells. Further, they indicate the importance of considering both affiliative and competitive interactions in investigating this relationship.

scholarly journals Mitochondrial DNA Copy Number Variation Across Human Cancers

2015 ◽  
Author(s):  
Ed Reznik ◽  
Martin Miller ◽  
Yasin Senbabaoglu ◽  
Nadeem Riaz ◽  
William Lee ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number Variation ◽  
Copy Number ◽  
Large Scale ◽  
Tumor Type ◽  
Mtdna Copy Number ◽  
Tissue Samples ◽  
Mitochondrial Dna Copy Number ◽  
Number Variation ◽  
Tumor Types

In cancer, mitochondrial dysfunction, through mutations, deletions, and changes in copy number of mitochondrial DNA (mtDNA), contributes to the malignant transformation and progression of tumors. Here, we report the first large-scale survey of mtDNA copy number variation across 21 distinct solid tumor types, examining over 13,000 tissue samples profiled with next-generation sequencing methods. We find a tendency for cancers, especially of the bladder and kidney, to be significantly depleted of mtDNA, relative to matched normal tissue. We show that mtDNA copy number is correlated to the expression of mitochondrially-localized metabolic pathways, suggesting that mtDNA copy number variation reflect gross changes in mitochondrial metabolic activity. Finally, we identify a subset of tumor-type-specific somatic alterations, including IDH1 and NF1 mutations in gliomas, whose incidence is strongly correlated to mtDNA copy number. Our findings suggest that modulation of mtDNA copy number may play a role in the pathology of cancer.

scholarly journals Concurrent Measurement of Mitochondrial DNA Copy Number and ATP Concentration in Single Bovine Oocytes

2021 ◽  
Vol 4 (4) ◽  
pp. 88
Author(s):  
Casey C. Read ◽  
Sadikshya Bhandari ◽  
Sarah E. Moorey
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Germinal Vesicle ◽  
Mtdna Copy Number ◽  
Dna Copy Number ◽  
Metabolic Substrates ◽  
Metabolic Outcomes ◽  
Atp Concentration ◽  
Mitochondrial Dna Copy Number ◽  
Bovine Oocytes

To sustain energy-demanding developmental processes, oocytes must accumulate adequate stores of metabolic substrates and mitochondrial numbers prior to the initiation of maturation. In the past, researchers have utilized pooled samples to study oocyte metabolism, and studies that related multiple metabolic outcomes in single oocytes, such as ATP concentration and mitochondrial DNA copy number, were not possible. Such scenarios decreased sensitivity to intraoocyte metabolic relationships and made it difficult to obtain adequate sample numbers during studies with limited oocyte availability. Therefore, we developed and validated procedures to measure both mitochondrial DNA (mtDNA) copy number and ATP quantity in single oocytes. Validation of our procedures revealed that we could successfully divide oocyte lysates into quarters and measure consistent results from each of the aliquots for both ATP and mtDNA copy number. Coefficient of variation between the values retrieved for mtDNA copy number and ATP quantity quadruplicates were 4.72 ± 0.98 and 1.61 ± 1.19, respectively. We then utilized our methodology to concurrently measure mtDNA copy number and ATP quantity in germinal vesicle (GV) and metaphase two (MII) stage oocytes. Our methods revealed a significant increase in ATP levels (GV = 628.02 ± 199.53 pg, MII = 1326.24 ± 199.86 pg, p < 0.001) and mtDNA copy number (GV = 490,799.4 ± 544,745.9 copies, MII = 1,087,126.9 ± 902,202.8 copies, p = 0.035) in MII compared to GV stage oocytes. This finding is consistent with published literature and provides further validation of the accuracy of our methods. The ability to produce consistent readings and expected results from aliquots of the lysate from a single oocyte reveals the sensitivity and feasibility of using this method.

Sign in / Sign up

Export Citation Format

Share Document