scholarly journals Mitochondrial DNA and their nuclear copies in parasitic wasp Pteromalus puparum: A comparative analysis in Chalcidoidea

2018 ◽  
Author(s):  
Zhichao Yan ◽  
Qi Fang ◽  
Yu Tian ◽  
Fang Wang ◽  
Xuexin Chen ◽  
...  
Keyword(s):  
Control Region ◽  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Mitochondrial Gene ◽  
Parasitic Wasp ◽  
Mitochondrial Genomes ◽  
Coding Regions ◽  
Pteromalus Puparum ◽  
Mitochondrial Origin ◽  
Nuclear Degradation

AbstractChalcidoidea (chalcidoid wasps) are an abundant and megadiverse insect group with both ecological and economical importance. Here we report a complete mitochondrial genome in Chalcidoidea from Pteromalus puparum (Pteromalidae). Eight tandem repeats followed by 6 reversed repeats were detected in its 3,308 bp control region. This long and complex control region may explain failures of amplifying and sequencing of complete mitochondrial genomes in some chalcidoids. In addition to 37 typical mitochondrial genes, an extra identical isoleucine tRNA (trnI) was detected. We speculate this recent mitochondrial gene duplication indicates that gene arrangements in chalcidoids are ongoing. A comparison among available chalcidoid mitochondrial genomes, reveals rapid gene order rearrangements overall, and high substitution rate in P. puparum. In addition, we identified 24 nuclear sequences of mitochondrial origin (NUMTs) in P. puparum, summing up to 9,989 bp, with 3,617 bp of these NUMTs originating from mitochondrial coding regions. NUMTs abundance in P. puparum is only one-twelfth of that in its relative, Nasonia vitripennis. Based on phylogenetic analysis, we provide evidence that a faster nuclear degradation rate contributes to the reduced NUMT numbers in P. puparum. Overall, our study shows unusually high rates of mitochondrial evolution and considerable variation in NUMT accumulation in Chalcidoidea.

scholarly journals Using high-resolution annotation of insect mitochondrial DNA to decipher tandem repeats in the control region

2018 ◽  
Author(s):  
Ji Haishuo ◽  
Xu Xiaofeng ◽  
Jin Xiufeng ◽  
Cheng Zhi ◽  
jin Hong ◽  
...  
Keyword(s):  
Steady State ◽  
High Resolution ◽  
Mitochondrial Genome ◽  
Control Region ◽  
Transcription Initiation ◽  
Tandem Repeats ◽  
Mitochondrial Gene ◽  
Mitochondrial Genomes ◽  
Small Rna Sequencing ◽  
Antisense Gene

In this study, we used a small RNA sequencing (sRNA-seq) based method to annotate the mitochondrial genome of the insect Erthesina fullo Thunberg at 1 bp resolution. Most of the new annotations were consistent with the previous annotations which were obtained using PacBio full-length transcripts. Two important findings are that animals transcribe both entire strands of mitochondrial genomes and the tandem repeat in the control region of the E. fullo mitochondrial genome contains the repeated Transcription Initiation Sites (TISs) of the H-strand. In addition, we found that the copy numbers of tandem repeats showed a great diversity within an individual, enriching the fundamental knowledge of mitochondrial biology. This sRNA-seq based method uses 5′ and 3′ end small RNAs to annotate nuclear non-coding and mitochondrial genes at 1 bp resolution and can also be used to identify new steady-state RNAs, particularly long non-coding RNAs (lncRNAs). Animal mitochondrial genomes containing one control region only encode two steady-state lncRNAs, which are the Mitochondrial D-loop 1 (MDL1) and its antisense gene (MDL1AS), while all other reported mitochondrial lncRNAs could be degraded fragments of transient RNAs or random breaks during experimental processing. The high-resolution annotations of mitochondrial genomes can be used to study the phylogenetics and molecular evolution of animals or to investigate mitochondrial gene transcription, RNA processing, RNA maturation and several other related topics.

Characterisation of the complete mitochondrial genome of the insect-parasitic nematode Heterorhabditis bacteriophora: an idiosyncratic gene order and the presence of multiple long non-coding regions

Nematology ◽  
2021 ◽  
pp. 1-18
Author(s):  
Sassia Omar Regeai ◽  
David A. Fitzpatrick ◽  
Ann M. Burnell ◽  
Thomais Kakouli-Duarte
Keyword(s):  
Control Region ◽  
Insect Pests ◽  
Biological Control Agent ◽  
Complete Mitochondrial Genome ◽  
Heterorhabditis Bacteriophora ◽  
Rrna Genes ◽  
Gene Arrangement ◽  
Trna Genes ◽  
Entire Genome ◽  
Coding Regions

Summary We present here the complete mtDNA genome (mitogenome) of Heterorhabditis bacteriophora, an important biological control agent of soil-dwelling insect pests in agriculture and horticulture. This is the first description of a mitogenome for a member of the family Heterorhabditidae. The genome contains the typical chromadorean complement of 12 protein-coding genes, 22 tRNA genes and two rRNA genes. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. For the entire genome, the nucleotide contents are 47.02% (T), 28.81% (A), 16.10% (G), 8.08% (C) and 75.83% (AT). Heterorhabditis bacteriophora has a unique, idiosyncratic gene arrangement. It differs from that of Caenorhabditis elegans in having a block of seven genes: trnQ-trnF-cytb-trnL1-cox3-trnT-nad4 translocated to a position between nad3 and nad5, as well as having a change in the position of the four tRNA block gene cluster, trnC-trnM-trnD-trnG, where trnC and trnM have switched places and trnD and trnG have translocated between nad4 and nad5 genes. The H. bacteriophora mitogenome is 18 128 bp long, and thus is ca 4 kb larger than the mitogenomes of most chromadoreans. This relatively large genome is due to the presence of five non-coding regions (NCR): NCR1 (114 bp), NCR2 (159 bp), NCR3 (498 bp), NCR4 (1917 bp) and NCR5 (2154 bp), which make up 26.7% of the genome. The NCR5 had the highest A + T content of 83.47% indicating that this region is the likely AT-rich control region. The complete 498 bp NCR3 sequence is duplicated in NCR4 and in NCR5 (the putative AT-rich control region). Such an organisation has not been reported previously in nematode mtDNA.

Complete mitochondrial genome of the endangered Mary River turtle (Elusor macrurus) and low mtDNA variation across the species' range

2016 ◽  
Vol 64 (2) ◽  
pp. 117 ◽  
Author(s):  
Daniel J. Schmidt ◽  
Brittany Brockett ◽  
Thomas Espinoza ◽  
Marilyn Connell ◽  
Jane M. Hughes
Keyword(s):  
Mitochondrial Genome ◽  
Control Region ◽  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Illumina Miseq ◽  
Base Pairs ◽  
Pet Trade ◽  
Nucleotide Variability ◽  
Natural Range ◽  
Miseq Platform

Elusor macrurus is an endangered short-necked turtle restricted to the Mary River catchment in south-eastern Queensland. Shotgun sequencing of genomic DNA was used to generate a complete mitochondrial genome sequence for E. macrurus using the Illumina MiSeq platform. The mitogenome is 16 499 base pairs (bp) long with 37 genes arranged in the typical vertebrate order and a relatively short 918-bp control region, which does not feature extensive tandem repeats as observed in some turtles. Primers were designed to amplify a 1270-bp region that includes 81% of the typically hypervariable control region. Two haplotypes were detected in a sample of 22 wild-caught individuals from eight sites across its natural range. The Mary River turtle is a species with low mtDNA nucleotide variability relative to other Chelidae. The combination of a very restricted distribution and dramatic reduction in population size due to exploitation for the pet trade are the conditions likely to have led to very low mtDNA variability in this endangered species.

scholarly journals The complete mitochondrial genome of the grooved carpet shell,Ruditapes decussatus(Bivalvia, Veneridae)

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3692 ◽  
Author(s):  
Fabrizio Ghiselli ◽  
Liliana Milani ◽  
Mariangela Iannello ◽  
Emanuele Procopio ◽  
Peter L. Chang ◽  
...  
Keyword(s):  
Mitochondrial Genome ◽  
Genetic Variability ◽  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Ruditapes Philippinarum ◽  
Mitochondrial Genomes ◽  
Uniparental Inheritance ◽  
Ruditapes Decussatus ◽  
Important Species ◽  
Two Samples

Despite the large number of animal complete mitochondrial genomes currently available in public databases, knowledge about mitochondrial genomics in invertebrates is uneven. This paper reports, for the first time, the complete mitochondrial genome of the grooved carpet shell,Ruditapes decussatus, also known as the European clam.Ruditapes decussatusis morphologically and ecologically similar to the Manila clamRuditapes philippinarum, which has been recently introduced for aquaculture in the very same habitats ofRuditapes decussatus, and that is replacing the native species. Currently the production of the European clam is almost insignificant, nonetheless it is considered a high value product, and therefore it is an economically important species, especially in Portugal, Spain and Italy. In this work we: (i) assembledRuditapes decussatusmitochondrial genome from RNA-Seq data, and validated it by Sanger sequencing; (ii) analyzed and characterized theRuditapes decussatusmitochondrial genome, comparing its features with those of other venerid bivalves; (iii) assessed mitochondrial sequence polymorphism (SP) and copy number variation (CNV) of tandem repeats across 26 samples. Despite using high-throughput approaches we did not find evidence for the presence of two sex-linked mitochondrial genomes, typical of the doubly uniparental inheritance of mitochondria, a phenomenon known in ∼100 bivalve species. According to our analyses,Ruditapes decussatusis more genetically similar to species of the Genus Paphia than to the congenericRuditapes philippinarum, a finding that bolsters the already-proposed need of a taxonomic revision. We also found a quite low genetic variability across the examined samples, with few SPs and little variability of the sequences flanking the control region (Largest Unassigned Regions (LURs). Strikingly, although we found low nucleotide variability along the entire mitochondrial genome, we observed high levels of length polymorphism in the LUR due to CNV of tandem repeats, and even a LUR length heteroplasmy in two samples. It is not clear if the lack of genetic variability in the mitochondrial genome ofRuditapes decussatusis a cause or an effect of the ongoing replacement ofRuditapes decussatuswith the invasiveRuditapes philippinarum, and more analyses, especially on nuclear sequences, are required to assess this point.

scholarly journals Complete mitochondrial genome of Indian tent turtle, Pangshura tentoria and comparative mitochondriomics

2018 ◽  
Author(s):  
Shantanu Kundu ◽  
Vikas Kumar ◽  
Kaomud Tyagi ◽  
Rajasree Chakraborty ◽  
Iftikar Rahaman ◽  
...  
Keyword(s):  
Mitochondrial Genome ◽  
Nadh Dehydrogenase ◽  
Tandem Repeats ◽  
Synonymous Codon ◽  
Complete Mitochondrial Genome ◽  
Mitochondrial Gene ◽  
Gene Arrangement ◽  
Bootstrap Support ◽  
Nadh Dehydrogenase Subunit ◽  
Strong Negative Selection

Complete mitochondrial genomes of Indian tent turtle, Pangshura tentoria was sequenced and annotated as 16,657 bp in length. This first assembly was encoded by 37 genes: 13 protein coding genes (PCGs), 22 transfer RNA (tRNAs), two ribosomal RNA (rRNAs) as similar to the typical vertebrate mitochondrial gene arrangement. The complete mitogenome has a base composition of A (33.30%), G (13.54%), C (27%), and T (26.13%). Most of the genes were encoded on major strand, except for the eight tRNAs and one PCG (nad6). Almost all PCGs were starting with an ATG initiation codon, except for cytochrome oxidase subunit 1 (cox1) with ‘GTG’ and NADH dehydrogenase subunit 5 (nad5) with ‘ATA’. The typical termination codons, ‘TAA’ and ‘AGA’ has been observed in NADH dehydrogenase subunit 4l (nad4l) and NADH dehydrogenase subunit 6 (nad6) respectively; and others were used incomplete stop codons. The Relative Synonymous Codon Usage (RSCU) analysis revealed the maximum abundance of Alanine, Isoleucine, Leucine, and Threonine in P. tentoria. Codon distribution per thousand codon (CDsPT) values for all the amino acids showed the maximum values were present for Leucine in all geoemydid turtles. Further, the PCGs showed non-synonymous (Ka)/synonymous (Ks) values were <1 that indicated a strong negative selection among the studied species. The tRNAs were folded into classic clover-leaf secondary structures, except for trnS (GCT), lacking of the conventional DHU arm or stem. Further, the 10 tRNAs showed G-T mismatches and forming weak bonds. In the control region (CR) of P. tentoria, a single tandem repeat of eight base pairs (TTCTCTTT) was resulted with two copy numbers. The comparative study of CR with other geoemydid turtles revealed the numbers of tandem repeats were frequent in the 3´ end and structural characteristic were species-specific. The Maximum Likelihood (ML) phylogeny showed 32 geoemydid turtles were clustered distinctly with high bootstrap support and congruent with the previous phylogenetic hypothesis. Further, the representative mitogenome sequences of other family/suborder were depicted discrete clades in the ML tree. The study argued the complete mitochondrial genome sequence of P. tentoria and comparative mitochondriomics of geoemydid turtles would be useful for further phylogenetic reconciliation and evolutionary research.

scholarly journals Precise annotation of tick mitochondrial genomes reveals multiple STR variation and one transposon-like element

2019 ◽  
Author(s):  
Ze Chen ◽  
Xiaofeng Xu ◽  
Xiaolong Yang ◽  
Zhijun Yu ◽  
Yonghong Hu ◽  
...  
Keyword(s):  
Complete Mitochondrial Genome ◽  
Mitochondrial Gene ◽  
Pcr Amplification ◽  
Mitochondrial Genomes ◽  
Accession Number ◽  
Intraindividual Variation ◽  
Dna Variation ◽  
Genomic Structural Variation ◽  
Repeat Units ◽  
Mitochondrial Gene Order

AbstractIn this study, we used long-PCR amplification combined with Next-Generation Sequencing (NGS) to obtain complete mitochondrial genomes of individual ticks and performed precise annotation of these genomes. These annotations were confirmed by the PacBio full-length transcriptome data to cover both entire strands of the mitochondrial genomes without any gaps or overlaps. Based on these annotations, most of our findings were consistent with those from previous studies. Moreover, two important findings were reported for the first time, contributing fundamental knowledge to mitochondrial biology. The first was the discovery of a transposon-like element that may reveal the mechanisms of mitochondrial gene order rearrangement and genomic structural variation. Another finding was that Short Tandem Repeat (STRs) are the dominant variation type causing mitochondrial sequence diversity within an individual tick, insect, mouse and human. Comparisons between interindividual and intraindividual variation showed that polynucleotides and STRs with longer repeat units had the same variation pattern. Particularly, mitochondria containing deleterious mutations can accumulate in cells and deleterious STR mutations irreversibly change the proteins made from their mRNAs. Therefore, we proposed that deleterious STR mutations in mitochondria cause aging and diseases. This finding helped to ultimately reveal the mechanisms of mitochondrial DNA variation and its consequences (e.g., aging and diseases) in animals. Our study will give rise to the reconsideration of the importance of STRs and a unified study of STR variation with longer and shorter repeat units (particularly polynucleotides) in both nuclear and mitochondrial genomes. The complete mitochondrial genome sequence of Dermacentor silvarum is available at the NCBI GenBank database under the accession number MN347015 and the raw data is available at the NCBI SRA database under the accession number SRP178347.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

2021 ◽  
Author(s):  
Handong Wang ◽  
Ye Chen ◽  
Wei Shi ◽  
Yongyao Guo ◽  
Jinghong He ◽  
...  
Keyword(s):  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Sister Group ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Mitochondrial Genomes ◽  
Evolutionary Analysis ◽  
Habitat Distribution ◽  
Remarkable Feature ◽  
Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

scholarly journals Comprehensive Analyses of the Complete Mitochondrial Genome of Figulus binodulus (Coleoptera: Lucanidae)

2020 ◽  
Vol 20 (5) ◽  
Author(s):  
Jungmo Lee ◽  
Jonghyun Park ◽  
Hong Xi ◽  
Jongsun Park
Keyword(s):  
Mitochondrial Genome ◽  
Gene Order ◽  
Complete Mitochondrial Genome ◽  
Mitochondrial Gene ◽  
Mitochondrial Genomes ◽  
Protein Coding ◽  
Transfer Rnas ◽  
Mitochondrial Gene Order ◽  
Rna Genes ◽  
Simple Sequence

Abstract Figulus binodulus Waterhouse is a small stag beetle distributed in East Asia. We determined the first mitochondrial genome of F. binodulus of which is 16,261-bp long including 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNAs, and a single large noncoding region of 1,717 bp. Gene order of F. binodulus is identical to the ancestral insect mitochondrial gene order as in most other stag beetle species. All of 22 tRNAs could be shaped into typical clover-leaf structure except trnSer1. Comparative analyses of 21 Lucanidae mitochondrial genomes was conducted in aspect of their length and AT-GC ratio. Nucleotide diversities analyses provide that cox1 and cox2 in Lucanidae are less diverse than those of Scarabaeoidea. Fifty simple sequence repeats (SSRs) were identified on F. binodulus mitochondrial genome. Comparative analysis of SSRs among five mitochondrial genomes displayed similar trend along with SSR types. Figulus binodulus was sister to all other available family Lucanidae species in the phylogenetic tree.

scholarly journals Complete mitochondrial genome of Indian tent turtle, Pangshura tentoria and comparative mitochondriomics

2018 ◽  
Author(s):  
Shantanu Kundu ◽  
Vikas Kumar ◽  
Kaomud Tyagi ◽  
Rajasree Chakraborty ◽  
Iftikar Rahaman ◽  
...  
Keyword(s):  
Mitochondrial Genome ◽  
Nadh Dehydrogenase ◽  
Tandem Repeats ◽  
Synonymous Codon ◽  
Complete Mitochondrial Genome ◽  
Mitochondrial Gene ◽  
Gene Arrangement ◽  
Bootstrap Support ◽  
Nadh Dehydrogenase Subunit ◽  
Strong Negative Selection

Complete mitochondrial genomes of Indian tent turtle, Pangshura tentoria was sequenced and annotated as 16,657 bp in length. This first assembly was encoded by 37 genes: 13 protein coding genes (PCGs), 22 transfer RNA (tRNAs), two ribosomal RNA (rRNAs) as similar to the typical vertebrate mitochondrial gene arrangement. The complete mitogenome has a base composition of A (33.30%), G (13.54%), C (27%), and T (26.13%). Most of the genes were encoded on major strand, except for the eight tRNAs and one PCG (nad6). Almost all PCGs were starting with an ATG initiation codon, except for cytochrome oxidase subunit 1 (cox1) with ‘GTG’ and NADH dehydrogenase subunit 5 (nad5) with ‘ATA’. The typical termination codons, ‘TAA’ and ‘AGA’ has been observed in NADH dehydrogenase subunit 4l (nad4l) and NADH dehydrogenase subunit 6 (nad6) respectively; and others were used incomplete stop codons. The Relative Synonymous Codon Usage (RSCU) analysis revealed the maximum abundance of Alanine, Isoleucine, Leucine, and Threonine in P. tentoria. Codon distribution per thousand codon (CDsPT) values for all the amino acids showed the maximum values were present for Leucine in all geoemydid turtles. Further, the PCGs showed non-synonymous (Ka)/synonymous (Ks) values were <1 that indicated a strong negative selection among the studied species. The tRNAs were folded into classic clover-leaf secondary structures, except for trnS (GCT), lacking of the conventional DHU arm or stem. Further, the 10 tRNAs showed G-T mismatches and forming weak bonds. In the control region (CR) of P. tentoria, a single tandem repeat of eight base pairs (TTCTCTTT) was resulted with two copy numbers. The comparative study of CR with other geoemydid turtles revealed the numbers of tandem repeats were frequent in the 3´ end and structural characteristic were species-specific. The Maximum Likelihood (ML) phylogeny showed 32 geoemydid turtles were clustered distinctly with high bootstrap support and congruent with the previous phylogenetic hypothesis. Further, the representative mitogenome sequences of other family/suborder were depicted discrete clades in the ML tree. The study argued the complete mitochondrial genome sequence of P. tentoria and comparative mitochondriomics of geoemydid turtles would be useful for further phylogenetic reconciliation and evolutionary research.

Sign in / Sign up

Export Citation Format

Share Document