scholarly journals Engineering bacteria for biogenic synthesis of chalcogenide nanomaterials

2018 ◽  
Author(s):  
Prithiviraj Chellamuthu ◽  
Frances Tran ◽  
Kalinga Pavan T. Silva ◽  
Moh El-Naggar ◽  
James Q. Boedicker
Keyword(s):  
Inorganic Materials ◽  
Biological Synthesis ◽  
Arsenic Sulfide ◽  
Heterologous Host ◽  
Biogenic Synthesis ◽  
Nanoscale Structures ◽  
E Coli ◽  
Thiosulfate Reductase ◽  
Serovar Typhimurium ◽  
Control Circuits

SummaryMicrobes naturally build nanoscale structures, including structures assembled from inorganic materials. Here we combine the natural capabilities of microbes with engineered genetic control circuits to demonstrate the ability to control biological synthesis of chalcogenide nanomaterials in a heterologous host. We transferred reductase genes from both Shewanella sp. ANA-3 and Salmonella enterica serovar Typhimurium into an heterologous host (Escherichia coli) and examined the mechanisms that regulate the properties of biogenic nanomaterials. Expression of arsenic reductase genes and thiosulfate reductase genes in E. coli resulted in the synthesis of arsenic sulfide nanomaterials. In addition to processing the starting materials via redox enzymes, cellular components also nucleated the formation of arsenic sulfide nanomaterials. The shape of the nanomaterial was influenced by the bacterial culture, with the synthetic E. coli strain producing nanospheres and conditioned media or cultures of wild type Shewanella sp. producing nanofibers. The diameter of these nanofibers also depended on the biological context of synthesis. These results demonstrate the potential for biogenic synthesis of nanomaterials with controlled properties by combining the natural capabilities of wild microbes with the tools from synthetic biology.

scholarly journals Engineering Hydrogen Sulfide Production and Cadmium Removal by Expression of the Thiosulfate Reductase Gene (phsABC) from Salmonella enterica Serovar Typhimurium in Escherichia coli

2000 ◽  
Vol 66 (9) ◽  
pp. 3939-3944 ◽  
Author(s):  
Sang-Weon Bang ◽  
Douglas S. Clark ◽  
Jay D. Keasling
Keyword(s):  
Escherichia Coli ◽  
Hydrogen Sulfide ◽  
Expression Vector ◽  
Inducible Expression ◽  
Anaerobic Conditions ◽  
E Coli ◽  
Thiosulfate Reductase ◽  
Reductase Gene ◽  
Serovar Typhimurium ◽  
Dna Fragment

ABSTRACT The thiosulfate reductase gene (phsABC) fromSalmonella enterica serovar Typhimurium was expressed inEscherichia coli to overproduce hydrogen sulfide from thiosulfate for heavy metal removal (or precipitation). A 5.1-kb DNA fragment containing phsABC was inserted into the pMB1-based, high-copy, isopropyl-β-d-thiogalactopyranoside-inducible expression vector pTrc99A and the RK2-based, medium-copy,m-toluate-inducible expression vector pJB866, resulting in plasmids pSB74 and pSB77. A 3.7-kb DNA fragment, excluding putative promoter and regulatory regions, was inserted into the same vectors, making plasmids pSB103 and pSB107. E. coli DH5α strains harboring the phsABC constructs showed higher thiosulfate reductase activity and produced significantly more sulfide than the control strains under both aerobic and anaerobic conditions. Among the four phsABC constructs, E. coli DH5α (pSB74) produced thiosulfate reductase at the highest level and removed the most cadmium from solution under anaerobic conditions: 98% of all concentrations up to 150 μM and 91% of 200 μM. In contrast, a negative control did not produce any measurable sulfide and removed very little cadmium from solution. Energy-dispersive X-ray spectroscopy revealed that the metal removed from solution precipitated as a complex of cadmium and sulfur, most likely cadmium sulfide.

Efficacy of Silver Nanoparticles Synthesized from Hymenocallis species (Spider Lilly) Leaf Extract as Antimicrobial Agents

2019 ◽  
Vol 12 (5) ◽  
pp. 4644-4647
Author(s):  
K.K. Gupta ◽  
Neha Kumari ◽  
Neha Sinha ◽  
Akruti Gupta
Keyword(s):  
Silver Nanoparticles ◽  
Leaf Extract ◽  
Antimicrobial Agents ◽  
Color Change ◽  
Bacterial Species ◽  
Antimicrobial Property ◽  
Biogenic Synthesis ◽  
E Coli ◽  
Light Yellow ◽  
Antibiotic Property

Biogenic synthesis of silver nanoparticles synthesized from Hymenocallis species (Spider Lilly) leaf extract was subjected for investigation of its antimicrobial property against four bacterial species (E. coli, Salmonella sp., Streptococcus sp. & Staphylococcus sp.). The results revealed that synthesized nanoparticles solution very much justify the color change property from initial light yellow to final reddish brown during the synthesis producing a characteristics absorption peak in the range of 434-466 nm. As antimicrobial agents, their efficacy was evaluated by analysis of variance in between the species and among the different concentration of AgNPs solution, which clearly showed that there was significant variation in the antibiotic property between the four different concentrations of AgNPs solution and also among four different species of bacteria taken under studies. However, silver nanoparticles solution of 1: 9 and 1:4 were proved comparatively more efficient as antimicrobial agents against four species of bacteria.

scholarly journals Knowledge extraction for assisted curation of summaries of bacterial transcription factor properties

Database ◽  
2020 ◽  
Vol 2020 ◽  
Author(s):  
Carlos-Francisco Méndez-Cruz ◽  
Antonio Blanchet ◽  
Alan Godínez ◽  
Ignacio Arroyo-Fernández ◽  
Socorro Gama-Castro ◽  
...  
Keyword(s):  
Transcriptional Regulation ◽  
Knowledge Extraction ◽  
Biomedical Literature ◽  
Main Role ◽  
E Coli ◽  
Bacterial Transcription ◽  
Manual Curation ◽  
New Knowledge ◽  
Serovar Typhimurium ◽  
K 12

Abstract Transcription factors (TFs) play a main role in transcriptional regulation of bacteria, as they regulate transcription of the genetic information encoded in DNA. Thus, the curation of the properties of these regulatory proteins is essential for a better understanding of transcriptional regulation. However, traditional manual curation of article collections to compile descriptions of TF properties takes significant time and effort due to the overwhelming amount of biomedical literature, which increases every day. The development of automatic approaches for knowledge extraction to assist curation is therefore critical. Here, we show an effective approach for knowledge extraction to assist curation of summaries describing bacterial TF properties based on an automatic text summarization strategy. We were able to recover automatically a median 77% of the knowledge contained in manual summaries describing properties of 177 TFs of Escherichia coli K-12 by processing 5961 scientific articles. For 71% of the TFs, our approach extracted new knowledge that can be used to expand manual descriptions. Furthermore, as we trained our predictive model with manual summaries of E. coli, we also generated summaries for 185 TFs of Salmonella enterica serovar Typhimurium from 3498 articles. According to the manual curation of 10 of these Salmonella typhimurium summaries, 96% of their sentences contained relevant knowledge. Our results demonstrate the feasibility to assist manual curation to expand manual summaries with new knowledge automatically extracted and to create new summaries of bacteria for which these curation efforts do not exist. Database URL: The automatic summaries of the TFs of E. coli and Salmonella and the automatic summarizer are available in GitHub (https://github.com/laigen-unam/tf-properties-summarizer.git).

scholarly journals An Improved Medium for Colistin Susceptibility Testing

2018 ◽  
Vol 56 (5) ◽  
Author(s):  
Konrad Gwozdzinski ◽  
Saina Azarderakhsh ◽  
Can Imirzalioglu ◽  
Linda Falgenhauer ◽  
Trinad Chakraborty
Keyword(s):  
Susceptibility Testing ◽  
Acquired Resistance ◽  
Multidrug Resistant ◽  
Colistin Resistance ◽  
Reliable Determination ◽  
Content Type ◽  
E Coli ◽  
Resistant Species ◽  
Mueller Hinton ◽  
Serovar Typhimurium

ABSTRACTThe plasmid-located colistin resistance genemcr-1confers low-level resistance to colistin, a last-line antibiotic against multidrug-resistant Gram-negative bacteria. Current CLSI-EUCAST recommendations require the use of a broth microdilution (BMD) method with cation-adjusted Mueller-Hinton (CA-MH) medium for colistin susceptibility testing, but approximately 15% of all MCR-1 producers are classified as sensitive in that broth. Here we report on an improved calcium-enhanced Mueller-Hinton (CE-MH) medium that permits simple and reliable determination ofmcr-1-containingEnterobacteriaceae. Colistin susceptibility testing was performed for 50mcr-1-containingEscherichia coliandKlebsiella pneumoniaeisolates, 7 intrinsically polymyxin-resistant species,K. pneumoniaeandE. coliisolates with acquired resistance to polymyxins due tomgrBandpmrBmutations, respectively, and 32mcr-1-negative, colistin-susceptible isolates ofAcinetobacter baumannii,Citrobacter freundii,Enterobacter cloacae,E. coli,K. pneumoniae, andSalmonella entericaserovar Typhimurium. A comparison of the colistin MICs determined in CA-MH medium and those obtained in CE-MH medium was performed using both the BMD and strip-based susceptibility test formats. We validated the data using an isogenic IncX4 plasmid lackingmcr-1. Use of the CE-MH broth provides clear separation between resistant and susceptible isolates in both BMD and gradient diffusion assays; this is true for bothmcr-1-containingEnterobacteriaceaeisolates and those exhibiting either intrinsic or acquired colistin resistance. CE-MH medium is simple to prepare and overcomes current problems associated with BMD and strip-based colistin susceptibility testing, and use of the medium is easy to implement in routine diagnostic laboratories, even in resource-poor settings.

scholarly journals First Report of a Foodborne Salmonella enterica Serovar Gloucester (4:i:l,w) ST34 Strain Harboring blaCTX–M–55 and qnrS Genes Located in IS26-Mediated Composite Transposon

2021 ◽  
Vol 12 ◽  
Author(s):  
Lili Li ◽  
Rikke Heidemann Olsen ◽  
Anhua Song ◽  
Jian Xiao ◽  
Chong Wang ◽  
...  
Keyword(s):  
Salmonella Enterica ◽  
Structural Unit ◽  
Bacterial Species ◽  
Meat Products ◽  
Sequence Type ◽  
E Coli ◽  
Serovar Typhimurium ◽  
Long Read ◽  
Phenotypic And Genotypic Characterization

Extended-spectrum β-lactamases (ESBLs) production and (fluoro)quinolone (FQ) resistance among Salmonella pose a public health threat. The objective of this study was the phenotypic and genotypic characterization of an ESBL-producing and nalidixic acid-resistant Salmonella enterica serovar Gloucester isolate (serotype 4:i:l,w) of sequence type 34 (ST34) from ready-to-eat (RTE) meat products in China. Whole-genome short and long read sequencing (HiSeq and MinION) results showed that it contained blaCTX–M–55, qnrS1, and tetB genes, with blaCTX–M–55 and qnrS1 located in chromosomal IS26-mediated composite transposon (IS26–qnrS1–IS3–Tn3–orf–blaCTX–M–55–ISEcp1–IS26). The same genetic structure was found in the chromosome of S. enterica subsp. enterica serovar Typhimurium strain and in several plasmids of Escherichia coli, indicating that the IS26-mediated composite transposon in the chromosome of S. Gloucester may originate from plasmids of E. coli and possess the ability to disseminate to Salmonella and other bacterial species. Besides, the structural unit qnrS1–IS3–Tn3–orf–blaCTX–M–55 was also observed to be linked with ISKpn19 in both the chromosomes and plasmids of various bacteria species, highlighting the contribution of the insertion sequences (IS26 and ISKpn19) to the co-dissemination of blaCTX–M–55 and qnrS1. To our knowledge, this is the first description of chromosomal blaCTX–M–55 and qnrS in S. Gloucester from RTE meat products. Our work expands the host range and provides additional evidence of the co-transfer of blaCTX–M–55 and qnrS1 among different species of Salmonella through the food chain.

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

scholarly journals Effect of Electron Beam Irradiation on Survival of Escherichia coli O157:H7 and Salmonella enterica serovar Thyphimurium in Minced Camel Meat during Refrigerated Storage

2019 ◽  
Author(s):  
A. Amiri ◽  
H. Zandi ◽  
H. Mozaffari Khosravi
Keyword(s):  
Escherichia Coli ◽  
Electron Beam ◽  
Electron Beam Irradiation ◽  
Escherichia Coli O157 ◽  
Refrigerated Storage ◽  
Beam Irradiation ◽  
E Coli ◽  
Serovar Typhimurium ◽  
Camel Meat ◽  
Meat Samples

Background: Electron beam irradiation is one of the effective ways to control foodborne pathogens. We evaluated the effect of electron beam irradiation on survival of Escherichia coli O157:H7 and Salmonella enterica serovar Thyphimurium in minced camel meat during refrigerated storage. Methods: The meat samples were inoculated with E. coli O157:H7 and S. enterica serovar Thyphimurium and then irradiated with doses of 0, 1, 2, 3, and 5 kGy. The samples were stored at 4±1 °C and evaluated microbiologically up to 10 days. Data were analyzed using SPSS software version 18. Results: The microbial loads of minced camel meat samples were significantly reduced (p<0.0001) with increasing the dose of irradiation. The most effective dose was 5 kGy that highly reduced S. enterica serovar Typhimurium, and completely destroyed E. coli O157:H7. However, E. coli O157:H7 was more sensitive to electron beam irradiation than S. enterica serovar Typhimurium. Conclusion: Electron beam irradiation effectively reduced the population of both E. coli O157:H7 and S. enterica serovar Typhimurium in minced camel meat in a dose dependent manner.

scholarly journals The Escherichia coli K-12 NarL and NarP Proteins Insulate the nrf Promoter from the Effects of Integration Host Factor

2006 ◽  
Vol 188 (21) ◽  
pp. 7449-7456 ◽  
Author(s):  
Douglas F. Browning ◽  
David J. Lee ◽  
Alan J. Wolfe ◽  
Jeffrey A. Cole ◽  
Stephen J. W. Busby
Keyword(s):  
Escherichia Coli ◽  
Response Regulator ◽  
Regulatory Region ◽  
Enteric Bacteria ◽  
Integration Host Factor ◽  
Host Factor ◽  
Receptor Protein ◽  
E Coli ◽  
Serovar Typhimurium ◽  
K 12

ABSTRACT The Escherichia coli K-12 nrf operon promoter can be activated fully by the FNR protein (regulator of fumarate and nitrate reduction) binding to a site centered at position −41.5. FNR-dependent transcription is suppressed by integration host factor (IHF) binding at position −54, and this suppression is counteracted by binding of the NarL or NarP response regulator at position −74.5. The E. coli acs gene is transcribed from a divergent promoter upstream from the nrf operon promoter. Transcription from the major acsP2 promoter is dependent on the cyclic AMP receptor protein and is modulated by IHF and Fis binding at multiple sites. We show that IHF binding to one of these sites, located at position −127 with respect to the nrf promoter, has a positive effect on nrf promoter activity. This activation is dependent on the face of the DNA helix, independent of IHF binding at other locations, and found only when NarL/NarP are not bound at position −74.5. Binding of NarL/NarP appears to insulate the nrf promoter from the effects of IHF. The acs-nrf regulatory region is conserved in other pathogenic E. coli strains and related enteric bacteria but differs in Salmonella enterica serovar Typhimurium.

Detection of Escherichia coli O157, Salmonella enterica Serovar Typhimurium, and Staphylococcal Enterotoxin B in a Single Sample Using Enzymatic Bio-Nanotransduction

2007 ◽  
Vol 70 (4) ◽  
pp. 841-850 ◽  
Author(s):  
JOSH R. BRANEN ◽  
MARTHA J. HASS ◽  
ERIN R. DOUTHIT ◽  
WUSI C. MAKI ◽  
A. LARRY BRANEN
Keyword(s):  
Escherichia Coli ◽  
Salmonella Enterica ◽  
Salmonella Enterica Serovar Typhimurium ◽  
Staphylococcal Enterotoxin B ◽  
Escherichia Coli O157 ◽  
Dna Templates ◽  
E Coli ◽  
Serovar Typhimurium ◽  
Biological Recognition ◽  
Enterotoxin B

Enzymatic bio-nanotransduction is a biological detection scheme based on the production of nucleic acid nano-signals (RNA) in response to specific biological recognition events. In this study, we applied an enzymatic bio-nanotransduction system to the detection of important food-related pathogens and a toxin. Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and staphylococcal enterotoxin B (SEB) were chosen because of the implications of these targets to food safety. Primary antibodies to each of the targets were used to functionalize magnetic beads and produce biological recognition elements (antibodies) conjugated to nano-signal–producing DNA templates. Immunomagnetic capture that was followed by in vitro transcription of DNA templates bound to target molecules produced RNA nano-signals specific for every target in the sample. Discrimination of RNA nano-signals with a standard enzyme-linked oligonucleotide fluorescence assay provided a correlation between nano-signal profiles and target concentrations. The estimated limit of detection was 2.4 × 103 CFU/ml for E. coli O157:H7, 1.9 × 104 CFU/ml for S. enterica serovar Typhimurium, and 0.11 ng/ml for SEB with multianalyte detection in buffer. Low levels of one target were also detected in the presence of interference from high levels of the other targets. Finally, targets were detected in milk, and detection was improved for E. coli O157 by heat treatment of the milk.

scholarly journals Functional assembly of nitrous oxide reductase provides insights into copper site maturation

2019 ◽  
Vol 116 (26) ◽  
pp. 12822-12827 ◽  
Author(s):  
Lin Zhang ◽  
Anja Wüst ◽  
Benedikt Prasser ◽  
Christoph Müller ◽  
Oliver Einsle
Keyword(s):  
Nitrous Oxide ◽  
Nitrous Oxide Reductase ◽  
Heterologous Production ◽  
Heterologous Host ◽  
Metal Centers ◽  
E Coli ◽  
Source Organism ◽  
Copper Site ◽  
Biosynthetic Machinery

The multicopper enzyme nitrous oxide reductase reduces the greenhouse gas N2O to uncritical N2as the final step of bacterial denitrification. Its two metal centers require an elaborate assembly machinery that so far has precluded heterologous production as a prerequisite for bioremediatory applications in agriculture and wastewater treatment. Here, we report on the production of active holoenzyme inEscherichia coliusing a two-plasmid system to produce the entire biosynthetic machinery as well as the structural gene for the enzyme. Using this recombinant system to probe the role of individual maturation factors, we find that the ABC transporter NosFY and the accessory NosD protein are essential for the formation of the [4Cu:2S] site CuZ, but not the electron transfer site CuA. Depending on source organism, the heterologous hostE. colican, in some cases, compensate for the lack of the Cu chaperone NosL, while in others this protein is strictly required, underlining the case for designing a recombinant system to be entirely self-contained.

Sign in / Sign up

Export Citation Format

Share Document