scholarly journals Transcriptome sequencing and delimitation of cryptic Oscarella species (O. carmela and O. pearsei sp. nov) from California, USA

2017 ◽  
Author(s):  
Alexander Ereskovsky ◽  
Daniel J. Richter ◽  
Dennis V. Lavrov ◽  
Klaske J. Schippers ◽  
Scott A. Nichols
Keyword(s):  
Mitochondrial Genome ◽  
Cryptic Species ◽  
Strong Support ◽  
Morphological Characteristics ◽  
Original Description ◽  
Mucus Production ◽  
Central California ◽  
Paracrystalline Inclusions ◽  
Morphological Differences ◽  
The Western Pacific

AbstractThe homoscleromorph sponge Oscarella carmela, first described from central California, USA is shown to represent two morphologically similar but phylogenetically distant species that are co-distributed. We here describe a new species as Oscarella pearsei, sp. nov. and redescribe Oscarella carmela; the original description was based upon material from both species. Further, we correct the identification of published genomic/transcriptomic resources that were originally attributed to O. carmela, and present new Illumina-sequenced transcriptome assemblies for each of these species, and the mitochondrial genome sequence for O. pearsei sp. nov. Using SSU and LSU ribosomal DNA and the mitochondrial genome, we report the phylogenetic relationships of these species relative to other Oscarella species, and find strong support for placement of O. pearsei sp. nov. in a clade defined by the presence of spherulous cells that contain paracrystalline inclusions; O. carmela lacks this cell type and is most closely related to the Western Pacific species, O. malakhovi. Oscarella pearsei sp. nov and O. carmela can be tentatively distinguished based upon gross morphological differences such as color, surface texture and extent of mucus production, but can be more reliably identified using mitochondrial and nuclear barcode sequencing, ultrastructural characteristics of cells in the mesohyl, and the morphology of the follicle epithelium which surrounds the developing embryo in reproductively active individuals. Usually, cryptic species are very closely related to each other, but in this case and in sponges generally, cryptic species may be very distantly related because sponges can be difficult to identify based upon gross morphological characteristics.

scholarly journals Cryptic species in a Vulnerable seabird: shorttailed albatross consists of two species

2020 ◽  
Vol 43 ◽  
pp. 375-386
Author(s):  
M Eda ◽  
T Yamasaki ◽  
H Izumi ◽  
N Tomita ◽  
S Konno ◽  
...  
Keyword(s):  
Cryptic Species ◽  
Morphological Characteristics ◽  
Conservation Strategy ◽  
Morphological Examination ◽  
Breeding Sites ◽  
First Case ◽  
Morphological Differences ◽  
Native Birds ◽  
Senkaku Islands ◽  
Species Being

The occurrence of cryptic species within a threatened taxon is rare, but where they do occur, understanding species boundaries is essential for planning an effective conservation strategy. The short-tailed albatross Phoebastria albatrus is a Vulnerable seabird that mainly breeds on Torishima and the Senkaku Islands in the western North Pacific. Although it has been tacitly regarded as a single management unit with 2 breeding sites, the species is known to comprise 2 genetically separated populations (Senkaku-type and Torishima-type). However, morphological examination of birds from both populations has not been conducted owing to the difficulty in accessing the Senkaku Islands. In this study, we examined the morphological differences between immigrants from the Senkaku Islands to Torishima (Senkaku-type) and native birds on Torishima (Torishima-type) and found significant differences in morphological characteristics between the 2 bird types. In general, Torishima-type birds were larger than Senkaku-type birds, whereas Senkaku-type birds had relatively longer beaks. Based on the morphological differences found in this study as well as genetic and ecological differences revealed in previous studies, we believe that Senkaku- and Torishima-type birds should be classified as different cryptic species. To the best of our knowledge, this is the first case of cryptic species being identified in a threatened avian species.

scholarly journals Morphological Characteristics of Male Genitalia in Some Species of the Genus Eurytoma (Eurytomidae, Hymenoptera)

2010 ◽  
Vol 44 (5) ◽  
pp. e-42-e-46 ◽  
Author(s):  
S. Klymenko
Keyword(s):  
Cryptic Species ◽  
Related Species ◽  
Male Genitalia ◽  
Morphological Characteristics ◽  
External Morphology ◽  
Species Complexes ◽  
Morphological Differences ◽  
Species Specific

Morphological Characteristics of Male Genitalia in Some Species of the GenusEurytoma(Eurytomidae, Hymenoptera)Based on the analysis of morphological characteristics of related species of the genusEurytoma, several groups of cryptic species poorly distinguishing by external morphology, but clearly confined to certain hosts are shown to have morphological differences of male genitalia that are highly species-specific and can be useful for identification of cryptic species of the genusEurytoma(E. rosaeNees,E. strigifronsThomson, andE. jaceaeMayr species complexes).

The complete mitochondrial genome of the cryptic species C of Aneura pinguis

2015 ◽  
Vol 28 (1) ◽  
pp. 112-113 ◽  
Author(s):  
Kamil Myszczyński ◽  
Alina Bączkiewicz ◽  
Monika Szczecińska ◽  
Katarzyna Buczkowska ◽  
Tomasz Kulik ◽  
...  
Keyword(s):  
Mitochondrial Genome ◽  
Cryptic Species ◽  
Complete Mitochondrial Genome

High divergence across the whole mitochondrial genome in the “pan-Antarctic” springtail Friesea grisea: Evidence for cryptic species?

Gene ◽  
2010 ◽  
Vol 449 (1-2) ◽  
pp. 30-40 ◽  
Author(s):  
Giulia Torricelli ◽  
Antonio Carapelli ◽  
Peter Convey ◽  
Francesco Nardi ◽  
Jeffrey L. Boore ◽  
...  
Keyword(s):  
Mitochondrial Genome ◽  
Cryptic Species

scholarly journals Characterization of Coolia spp. (Gonyaucales, Dinophyceae) from Southern Tunisia: first record of Coolia malayensis in the Mediterranean Sea

ALGAE ◽  
2021 ◽  
Vol 36 (3) ◽  
pp. 175-193
Author(s):  
Moufida Abdennadher ◽  
Amel Bellaaj Zouari ◽  
Walid Medhioub ◽  
Antonella Penna ◽  
Asma Hamza
Keyword(s):  
Electron Microscopy ◽  
Mediterranean Sea ◽  
Phylogenetic Trees ◽  
Eastern Mediterranean ◽  
First Record ◽  
Morphological Characterization ◽  
Mucus Production ◽  
Rdna Sequences ◽  
The Mediterranean ◽  
Morphological Differences

This study provides the first report of the presence of Coolia malayensis in the Mediterranean Sea, co-occurring with C. monotis. Isolated strains from the Gulf of Gabès, Tunisia (South-eastern Mediterranean) were identified by morphological characterization and phylogenetic analysis. Examination by light and scanning electron microscopy revealed no significant morphological differences between the Tunisian isolates and other geographically distant strains of C. monotis and C. malayensis. Phylogenetic trees based on ITS1-5.8S-ITS2 and D1‒D3/28S rDNA sequences showed that C. monotis strains clustered with others from the Mediterranean and Atlantic whereas the C. malayensis isolate branched with isolates from the Pacific and the Atlantic, therefore revealing no geographical trend among C. monotis and C. malayensis populations. Ultrastructural analyses by transmission electron microscopy revealed the presence of numerous vesicles containing spirally coiled fibers in both C. malayensis and C. monotis cells, which we speculate to be involved in mucus production.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Ficophagus (Nematoda: Aphelenchoididae) from sycones of Ficus subgenus Urostigma, sections Malvanthera and Urostigma, in eastern Australia

Nematology ◽  
2020 ◽  
Vol 22 (6) ◽  
pp. 627-653
Author(s):  
Kerrie A. Davies ◽  
Faerlie Bartholomaeus ◽  
Dong Mei Li ◽  
Zeng Qi Zhao ◽  
Weimin Ye ◽  
...  
Keyword(s):  
New South ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Female Tail ◽  
South Wales ◽  
Eastern Australia ◽  
Two New Species ◽  
Morphological Differences ◽  
Tail Tip ◽  
Molecular Sequencing

Summary Ficophagus from collecting trips in eastern Australia, made over 15 years, are summarised and show that species of the genus occurred widely in sycones of Ficus, subgenus Urostigma, section Malvanthera. Two new species (based on morphological differences and molecular sequencing) are described: Ficophagus elizabethae sp. n. from Ficus macrophylla, F. rubiginosa and F. obliqua, and Ficophagus richardi sp. n. from Ficus obliqua; and a morphospecies, Ficophagus Morphospecies malandicus from Ficus obliqua. Ficophagus elizabethae sp. n. is characterised by having the excretory pore (EP) opening from the level of the junction of the conus and shaft of the stylet to that of the knobs, a relatively long procorpus (1.0-2.5 times length of stylet), female tail with an obliquely truncate tail with a hyaline area and a finely to broadly rounded tip which may be mucronate; post-vulval uterine sac (PUS) ca one vulval body diam. (VBD) in length; rose-thorn-shaped spicule with distinct rostrum and prominent condylus; and genital papillae arranged as largest pair adcloacal, second pair posterior to mid-tail length, and third small pair near tail tip; and was collected from Sydney in New South Wales, to Bundaberg in Queensland (QLD). Ficophagus richardi sp. n. is characterised by having the EP opening at the level of the junction of the stylet shaft and conus, a labial cap which is raised around the opening for the stylet; procorpus 0.8-1.7 times length of the stylet, PUS <1 VBD in length, long uterus, and female tail with a V-shaped hyaline area at the bluntly rounded tip; rose-thorn-shaped spicule with a small rostrum and prominent condylus, three pairs genital papillae, first and largest on anterior cloacal lip, second at 70% of tail length measured from cloacal aperture, and third near tip, and was collected from Ban Ban Springs in the south to the Bundaberg region in the mid-north of QLD. In addition, in the absence of pertinent molecular sequences, a morphospecies is described. Ficophagus Morphospecies malandicus is characterised by having the EP opening anterior to the junction of the stylet conus and shaft, procorpus 0.9-2 times length of stylet, a short PUS usually <1 VBD long, short uterus, rose-thorn-shaped spicule with a raised condylus and prominent rostrum, and three pairs of subventral papillae on the tail (one adcloacal, one posterior to mid-tail and one near tail tip); and was collected from the Atherton Tableland, QLD. A table comparing morphological characteristics is provided to help with identification of Ficophagus nematodes from figs of the section Malvanthera in eastern Australia.

scholarly journals Molecular and morphological evidence reveal a new genus and species in Auriculariales from tropical China

MycoKeys ◽  
2018 ◽  
Vol 35 ◽  
pp. 27-39 ◽  
Author(s):  
Hai-Sheng Yuan ◽  
Xu Lu ◽  
Cony Decock
Keyword(s):  
New Species ◽  
Dna Sequences ◽  
Type Species ◽  
New Genus ◽  
Phylogenetic Analyses ◽  
Strong Support ◽  
Morphological Characteristics ◽  
Morphological Evidence ◽  
New Genus And Species ◽  
Tropical China

Grammatuslabyrinthinusgen. et sp. nov. is proposed based on DNA sequences data and morphological characteristics. It is known so far from southern, tropical China. The new species is characterised by an annual, resupinate basidiocarp with a shallow, subporoid hymenophore, a hymenium restricted to the bottom of the tubes, a dimitic hyphal system, presence of encrusted skeletocystidia and dendrohyphidia, longitudinally septate basidia and smooth, oblong-ellipsoid to cylindrical, acyanophilous basidiospores. Phylogenetic analyses based on ITS + nLSU DNA sequences data indicate that G.labyrinthinus belongs to Auriculariaceae in which it has an isolated position. Phylogenetic inferences show G.labyrinthinus to be related to Heteroradulum. However, the ITS sequences similarity between G.labyrinthinus and H.kmetii, the type species of Heteroradulum, were 89.84% and support the establishment of the new genus. Inversely, Heteroradulumsemis clustered with G.labyrinthinus with strong support and it is transferred to Grammatus.

Confirmation of Aedes koreicus (Diptera: Culicidae) in Belgium and description of morphological differences between Korean and Belgian specimens validated by molecular identification

Zootaxa ◽  
2012 ◽  
Vol 3191 (1) ◽  
pp. 21 ◽  
Author(s):  
VEERLE VERSTEIRT ◽  
JAMES E. PECOR ◽  
DINA M. FONSECA ◽  
MARC COOSEMANS ◽  
WIM VAN BORTEL
Keyword(s):  
Korean Peninsula ◽  
Morphological Characteristics ◽  
Rapid Identification ◽  
Molecular Evidence ◽  
Island Population ◽  
Morphological Comparison ◽  
Aedes Koreicus ◽  
Island Populations ◽  
Molecular Comparison ◽  
Morphological Differences

In 2008, specimens resembling Aedes (Finlaya) koreicus (Edwards) (also Ochlerotatus koreicus or Hulecoeteomyia kore-ica) were found in Belgium during a national mosquito survey (MODIRISK). Small but consistent differences were, how-ever, observed between the specimens described from Peninsula Korea and those found in Belgian. To achieve the correctidentification a detailed morphological comparison was made between the Belgian specimens and reference material fromKorean mainland and island populations housed at the Smithsonian Institution (Walter Reed Biosystematics Unit (WR-BU), Washington, USA). The identification was furthermore supported by molecular evidence based on the ND4 region(mtDNA) of available Korean and Belgian mosquito specimens. Morphological and molecular comparison confirmed theinitial identification of Aedes koreicus. Based on morphological characteristics, the species collected in Belgium mostlikely originated from Jeju-do, an island south of the Korean Peninsula. The observed dissimilarities between Korean andBelgian specimens resembled a number of morphological differences mentioned previously between female adults col-lected on the Korean Peninsula and Jeju-do. This is the first report of Aedes koreicus outside its natural distribution range.A correct and rapid identification of new invading and spreading vector species is crucial for the implementation of effec-tive control measurements. Hence a correct and easy accessible description of all possible variations of species arrivingin new areas is highly recommended. Therefore, a comparative morphological study on the Smithsonian material of thespecies from Korean mainland, island population and from Belgium is given, pictures of the main aberrant characteristicsand scanning electron microscope images of all stages of the species are included and molecular confirmation of the identification based on the mtDNA ND4 region is provided.

Cryptic species complexes in manipulative echinostomatid trematodes: when two become six

Parasitology ◽  
2008 ◽  
Vol 136 (2) ◽  
pp. 241-252 ◽  
Author(s):  
T. L. F. LEUNG ◽  
D. B. KEENEY ◽  
R. POULIN
Keyword(s):  
Cryptic Species ◽  
Phylogenetic Analyses ◽  
Morphological Characteristics ◽  
Single Species ◽  
Distinct Species ◽  
Molecular Data ◽  
Spatial Segregation ◽  
Small Scale ◽  
Intermediate Hosts ◽  
Species Complexes

SUMMARYRecent studies have shown that some digenean trematodes previously identified as single species due to the lack of distinguishing morphological characteristics actually consist of a number of genetically distinct cryptic species. We obtained mitochondrial 16S and nuclear ITS1 sequences for the redial stages of Acanthoparyphium sp. and Curtuteria australis collected from snails and whelks at various locations around Otago Peninsula, New Zealand. These two echinostomes are well-known host manipulators whose impact extends to the entire intertidal community. Using phylogenetic analyses, we found that Acanthoparyphium sp. is actually composed of at least 4 genetically distinct species, and that a cryptic species of Curtuteria occurs in addition to C. australis. Molecular data obtained for metacercariae dissected from cockle second intermediate hosts matched sequences obtained for Acanthoparyphium sp. A and C. australis rediae, respectively, but no other species. The various cryptic species of both Acanthoparyphium and Curtuteria also showed an extremely localized pattern of distribution: some species were either absent or very rare in Otago Harbour, but reached far higher prevalence in nearby sheltered inlets. This small-scale spatial segregation is unexpected as shorebird definitive hosts can disperse trematode eggs across wide geographical areas, which should result in a homogeneous mixing of the species on small geographical scales. Possible explanations for this spatial segregation of the species include sampling artefacts, local adaptation by first intermediate hosts, environmental conditions, and site fidelity of the definitive hosts.

Sign in / Sign up

Export Citation Format

Share Document