scholarly journals Model communities hint to promiscuous metabolic linkages between ubiquitous free-living freshwater bacteria

2017 ◽  
Author(s):  
Sarahi L Garcia ◽  
Moritz Buck ◽  
Joshua J. Hamilton ◽  
Christian Wurzbacher ◽  
Magnus Alm Rosenblad ◽  
...  
Keyword(s):  
Time Series ◽  
Comparative Genomics ◽  
Mixed Cultures ◽  
Biosynthetic Pathways ◽  
Free Living ◽  
Freshwater Bacteria ◽  
Interaction Partners ◽  
Microbial Associations ◽  
Occurrence Patterns ◽  
Freshwater Environments

AbstractFree-living microorganisms with streamlined genomes are very abundant in the environment. Genome streamlining results in losses in the cell’s biosynthetic potential generating physiological dependencies between microorganisms. However, there exists no consensus on the specificity of these microbial associations. To verify specificity and extent of these associations, mixed cultures were established from three different freshwater environments. These cultures contained free-living streamlined organisms lacking multiple biosynthetic pathways. Among the co-occurring members of the mixed cultures, there was no clear recurring pattern of metabolic complementarity and dependencies. This, together with weak temporal co-occurrence patterns observed using time-series metagenomics, suggests that free-living freshwater bacteria form loose and unspecific cooperative loops. Comparative genomics suggests that the proportion of accessory genes in populations of streamlined bacteria allows for flexibility in interaction partners. Altogether this renders these free-living bacterial lineages functionally versatile despite their streamlining tendencies.

scholarly journals Model Communities Hint at Promiscuous Metabolic Linkages between Ubiquitous Free-Living Freshwater Bacteria

mSphere ◽  
2018 ◽  
Vol 3 (3) ◽  
Author(s):  
Sarahi L. Garcia ◽  
Moritz Buck ◽  
Joshua J. Hamilton ◽  
Christian Wurzbacher ◽  
Hans-Peter Grossart ◽  
...  
Keyword(s):  
Community Members ◽  
Cell Level ◽  
Free Living ◽  
Associated Bacteria ◽  
Metabolic Versatility ◽  
Freshwater Bacteria ◽  
Interaction Partners ◽  
Aquatic Microorganisms ◽  
Microbial Associations ◽  
Freshwater Environments

ABSTRACT Genome streamlining is frequently observed in free-living aquatic microorganisms and results in physiological dependencies between microorganisms. However, we know little about the specificity of these microbial associations. In order to examine the specificity and extent of these associations, we established mixed cultures from three different freshwater environments and analyzed the cooccurrence of organisms using a metagenomic time series. Free-living microorganisms with streamlined genomes lacking multiple biosynthetic pathways showed no clear recurring pattern in their interaction partners. Free-living freshwater bacteria form promiscuous cooperative associations. This notion contrasts with the well-documented high specificities of interaction partners in host-associated bacteria. Considering all data together, we suggest that highly abundant free-living bacterial lineages are functionally versatile in their interactions despite their distinct streamlining tendencies at the single-cell level. This metabolic versatility facilitates interactions with a variable set of community members.

scholarly journals A Time-Series Data Generation Method to Predict Remaining Useful Life

Processes ◽  
2021 ◽  
Vol 9 (7) ◽  
pp. 1115
Author(s):  
Gilseung Ahn ◽  
Hyungseok Yun ◽  
Sun Hur ◽  
Si-Yeong Lim
Keyword(s):  
Time Series ◽  
Time Series Data ◽  
Remaining Useful Life ◽  
Series Data ◽  
Generation Model ◽  
Data Generation ◽  
Training Time ◽  
Symbolic Aggregate Approximation ◽  
Useful Life ◽  
Occurrence Patterns

Accurate predictions of remaining useful life (RUL) of equipment using machine learning (ML) or deep learning (DL) models that collect data until the equipment fails are crucial for maintenance scheduling. Because the data are unavailable until the equipment fails, collecting sufficient data to train a model without overfitting can be challenging. Here, we propose a method of generating time-series data for RUL models to resolve the problems posed by insufficient data. The proposed method converts every training time series into a sequence of alphabetical strings by symbolic aggregate approximation and identifies occurrence patterns in the converted sequences. The method then generates a new sequence and inversely transforms it to a new time series. Experiments with various RUL prediction datasets and ML/DL models verified that the proposed data-generation model can help avoid overfitting in RUL prediction model.

scholarly journals Comparative Genomics Reveals Broad Genetic Diversity, Extensive Recombination and Nascent Ecological Adaptation in Micrococcus luteus

2021 ◽  
Author(s):  
Yisong Li ◽  
Zhong-Zhi Sun ◽  
Jin-Cheng Rong ◽  
Bin-Bin Xie
Keyword(s):  
Genetic Diversity ◽  
Comparative Genomics ◽  
Evolutionary History ◽  
Micrococcus Luteus ◽  
Genomic Diversity ◽  
Genome Wide Association ◽  
Gene Gain ◽  
Free Living ◽  
Genome Wide ◽  
Gain Loss

Abstract Background: Micrococcus luteus is a group of actinobacteria that is widely used in biotechnology and is being thought as an emerging nosocomial pathogen. With one of the smallest genomes of free-living actinobacteria, it is found in a wide range of environments, but intraspecies genetic diversity and adaptation strategies to various environments remain unclear. Here, comparative genomics, phylogenomics, and genome-wide association studies were used to investigate the genomic diversity, evolutionary history, and the potential ecological differentiation of the species.Results: High-quality genomes of 66 M. luteus strains were downloaded from the NCBI GenBank database and core and pan-genome analysis revealed a considerable intraspecies heterogeneity. Phylogenomic analysis, gene content comparison, and average nucleotide identity calculation consistently indicated that the species has diverged into three well-differentiated clades. Population structure analysis further suggested the existence of an unknown ancestor or the fourth, yet unsampled, clade. Reconstruction of gene gain/loss events along the evolutionary history revealed both early events that contributed to the inter-clade divergence and recent events leading to the intra-clade diversity. We also found convincing evidence that recombination has played a key role of the evolutionary process of the species, with upto two-thirds of the core genes have been affected by recombination. Furthermore, distribution of mammal-associated strains (including pathogens) on the phylogenetic tree suggested that the last common ancestor had a free-living lifestyle, and a few recently diverged lineages have developed a mammal-associated lifestyle separately. Consistently, genome-wide association analysis revealed that mammal-associated strains from different lineages shared genes functionally relevant to the host-associated lifestyle, indicating a recent ecological adaption to the new host-associated habitats.Conclusions: These results revealed high intraspecies genomic diversity of M. luteus and highlighted that gene gain/loss events and extensive recombination events played key roles in the genome evolution. Our study also indicated that, as a free-living species, some lineages have recently developed or are developing a mammal-associated lifestyle. This study provides insights into the mechanisms that drive the genome evolution and adaption to various environments of a bacterial species.

Comparative Analysis Between Paramecium Strains with Different Syngens Using the RAPD Method

2021 ◽  
Author(s):  
Sonoko Matsumoto ◽  
Kenta Watanabe ◽  
Akiko Imamura ◽  
Masato Tachibana ◽  
Takashi Shimizu ◽  
...  
Keyword(s):  
Rapd Analysis ◽  
Random Amplified Polymorphic Dna ◽  
Mating Types ◽  
Genetic Classification ◽  
Reaction Conditions ◽  
Free Living ◽  
Simple Method ◽  
Specific Band ◽  
Freshwater Environments

Abstract Paramecium spp. is types of free-living protists that live in freshwater environments. They are ciliates with high motility and phagocytosis and have been used to analyze cell motility and as a host model for pathogens. Besides such biological characteristics, apart from the usual morphological and genetic classification of species, the existence of taxonomies (such as syngens) and mating types related to Paramecium’s unique reproduction is known. In this study, we attempted to develop a simple method to identify Paramecium strains, which are difficult to distinguish morphologically, using random amplified polymorphic DNA (RAPD) analysis. Consequently, we can observe strain-specific band patterns. We also confirm that the presence of endosymbiotic Chlorella cells affects the band pattern of P. bursaria. Furthermore, the results of the RAPD analysis using several P. caudatum strains with different syngens show that it is possible to detect a band specific to a certain syngen. By improving the reaction conditions and random primers, based on the results of this study, RAPD analysis can be applied to the identification of Paramecium strains and their syngen confirmation tests.

scholarly journals Uneven distribution of cobamide biosynthesis and dependence in bacteria predicted by comparative genomics

2018 ◽  
Author(s):  
Amanda N. Shelton ◽  
Erica C. Seth ◽  
Kenny C. Mok ◽  
Andrew W. Han ◽  
Samantha N. Jackson ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Biosynthetic Pathway ◽  
De Novo ◽  
Bacterial Species ◽  
Vitamin B ◽  
Biosynthetic Pathways ◽  
Biosynthesis Pathway ◽  
Data Set ◽  
Enzyme Families ◽  
Lower Ligand

AbstractThe vitamin B12 family of cofactors known as cobamides are essential for a variety of microbial metabolisms. We used comparative genomics of 11,000 bacterial species to analyze the extent and distribution of cobamide production and use across bacteria. We find that 86% of bacteria in this data set have at least one of 15 cobamide-dependent enzyme families, yet only 37% are predicted to synthesize cobamides de novo. The distribution of cobamide biosynthesis varies at the phylum level, with 57% of Actinobacteria, 45% of Proteobacteria, and 30% of Firmicutes, and less than 1% of Bacteroidetes containing the complete biosynthetic pathway. Cobamide structure could be predicted for 58% of cobamide-producing species, based on the presence of signature lower ligand biosynthesis and attachment genes. Our predictions also revealed that 17% of bacteria that have partial biosynthetic pathways, yet have the potential to salvage cobamide precursors. These include a newly defined, experimentally verified category of bacteria lacking the first step in the biosynthesis pathway. These predictions highlight the importance of cobamide and cobamide precursor crossfeeding as examples of nutritional dependencies in bacteria.

scholarly journals Recombinant DNA resources for the comparative genomics ofAncylostoma ceylanicum

2016 ◽  
Author(s):  
Wadim J. Kapulkin ◽  
Adriana Magalska ◽  
Ewa Janecka ◽  
Arkadiusz Ciesielski ◽  
Malgorzata Lobocka ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Developmental Stages ◽  
Recombinant Dna ◽  
Genomic Library ◽  
Genetic Model ◽  
Model Organism ◽  
General Interest ◽  
Ancylostoma Ceylanicum ◽  
Free Living ◽  
C Elegans

AbstractWe describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm,Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5‘-linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematodeC. elegansandA. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organismC. elegansand closely related parasitic species. We discuss the potential and relevance ofAncylostoma ceylanicumdata and resources generated by the recombinant DNA approach.

Sign in / Sign up

Export Citation Format

Share Document