scholarly journals Retroviral origins of theCaenorhabditis elegansorphan gene F58H7.5

2016 ◽  
Author(s):  
Wadim J Kapulkin
Keyword(s):  
Genetic Model ◽  
Genetic Research ◽  
Model Organism ◽  
Endogenous Retrovirus ◽  
Long Terminal Repeats ◽  
Orphan Gene ◽  
C Elegans ◽  
Infection Event ◽  
New Gene ◽  
Genome Scale

AbstractThis work describes the results of the genome-scale analysis of endogenous retrovirus insertions in twoC. elegansisolates: the prototype N2 (Bristol) and CB4856 (Hawaii). In total thirteen, identification of potentially replication competent, endogenous retroviral elements is described. Ten elements were identified as conserved between N2 and CB4856 by the reciprocal match of paired LTRs. The description focuses on the particular endogenous retrovirus insertion wich is identified on the proximal arm of the chromosome IV (located at positions IV: 912,948 – 921,658 and IV: 899,767 – 908,485 of the N2 and CB4856 respectively). In both isolates the inserted provirus is flanked by the predicted long terminal repeats (LTR)s of the length of 415 bp and of identical sequence. Provided the absolute LTR sequence identity this particular provirus represents insertion acquired prior to split from the common ancestor, suggesting this insertion event is evolutionary recent. The identified insertion of the endogenous retrovirus embeds the orphan gene F58H7.5, specific toC. eleganslineage. This unprecedented example establishes that in the evolutionary pastC. elegans, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.ImportanceThis work describes the retroviral origins ofC. elegansorphan gene F58H7.5. Presented work implies that in the evolutionary past theC. eleganshave acquired new gene as a result of the infection event.C. elegansis presently regarded as genetic model organism widely used in genetic research. The genome ofC. eleganshave been sequenced nearly 20 years ago. This unprecedented example establishes that in the evolutionary past C. elegans genome, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.

scholarly journals Alzheimer’s disease-relevant tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model

2020 ◽  
Author(s):  
Sanjib Guha ◽  
Sarah Fischer ◽  
Gail VW Johnson ◽  
Keith Nehrke
Keyword(s):  
Alzheimer’S Disease ◽  
Alzheimer's Disease ◽  
Genetic Model ◽  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Single Copy ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Touch Receptor Neurons ◽  
New Perspective

ABSTRACTBackgroundA defining pathological hallmark of the progressive neurodegenerative disorder Alzheimer’s disease (AD) is the accumulation of misfolded tau with abnormal post-translational modifications (PTMs). These include phosphorylation at Threonine 231 (T231) and acetylation at Lysine 274 (K274) and at Lysine 281 (K281). Although tau is recognized to play a central role in pathogenesis of AD, the precise mechanisms by which these abnormal PTMs contribute to the neural toxicity of tau is unclear.MethodsHuman 0N4R tau (wild type) was expressed in touch receptor neurons of the genetic model organism C. elegans through single-copy gene insertion. Defined mutations were then introduced into the single-copy tau transgene through CRISPR-Cas9 genome editing. These mutations included T231E and T231A, to mimic phosphorylation and phospho-ablation of a commonly observed pathological epitope, respectively, and K274/281Q, to mimic disease-associated lysine acetylation. Stereotypical touch response assays were used to assess behavioral defects in the transgenic strains as a function of age, and genetically-encoded fluorescent biosensors were used to measure the morphological dynamics and turnover of touch neuron mitochondria.ResultsUnlike existing tau overexpression models, C. elegans single-copy expression of tau did not elicit overt pathological phenotypes at baseline. However, strains expressing disease associated PTM-mimetics (T231E and K274/281Q) exhibited reduced touch sensation and morphological abnormalities that increased with age. In addition, the PTM-mimetic mutants lacked the ability to engage mitophagy in response to mitochondrial stress.ConclusionsLimiting the expression of tau results in a genetic model where pathological modifications and age result in evolving phenotypes, which may more closely resemble the normal progression of AD. The finding that disease-associated PTMs suppress compensatory responses to mitochondrial stress provides a new perspective into the pathogenic mechanisms underlying AD.

scholarly journals Calcineurin homologous proteins regulate the membrane localization and activity of sodium/proton exchangers in C. elegans

2016 ◽  
Vol 310 (3) ◽  
pp. C233-C242 ◽  
Author(s):  
Erik Allman ◽  
Qian Wang ◽  
Rachel L. Walker ◽  
Molly Austen ◽  
Maureen A. Peters ◽  
...  
Keyword(s):  
Genetic Model ◽  
Expression Patterns ◽  
Critical Role ◽  
Model Organism ◽  
Loss Of Function ◽  
Homologous Proteins ◽  
Relative Significance ◽  
C Elegans ◽  
Fluorescent Tags

Calcineurin B homologous proteins (CHP) are N-myristoylated, EF-hand Ca2+-binding proteins that bind to and regulate Na+/H+ exchangers, which occurs through a variety of mechanisms whose relative significance is incompletely understood. Like mammals, Caenorhabditis elegans has three CHP paralogs, but unlike mammals, worms can survive CHP loss-of-function. However, mutants for the CHP ortholog PBO-1 are unfit, and PBO-1 has been shown to be required for proton signaling by the basolateral Na+/H+ exchanger NHX-7 and for proton-coupled intestinal nutrient uptake by the apical Na+/H+ exchanger NHX-2. Here, we have used this genetic model organism to interrogate PBO-1's mechanism of action. Using fluorescent tags to monitor Na+/H+ exchanger trafficking and localization, we found that loss of either PBO-1 binding or activity caused NHX-7 to accumulate in late endosomes/lysosomes. In contrast, NHX-2 was stabilized at the apical membrane by a nonfunctional PBO-1 protein and was only internalized following its complete loss. Additionally, two pbo-1 paralogs were identified, and their expression patterns were analyzed. One of these contributed to the function of the excretory cell, which acts like a kidney in worms, establishing an alternative model for testing the role of this protein in membrane transporter trafficking and regulation. These results lead us to conclude that the role of CHP in Na+/H+ exchanger regulation differs between apical and basolateral transporters. This further emphasizes the importance of proper targeting of Na+/H+ exchangers and the critical role of CHP family proteins in this process.

scholarly journals Tauopathy-associated tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model

2020 ◽  
Vol 15 (1) ◽  
Author(s):  
Sanjib Guha ◽  
Sarah Fischer ◽  
Gail V. W. Johnson ◽  
Keith Nehrke
Keyword(s):  
Genetic Model ◽  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Single Copy ◽  
Neuronal Morphology ◽  
Mitochondrial Morphology ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Touch Receptor Neurons ◽  
New Perspective

Abstract Background A defining pathological hallmark of the progressive neurodegenerative disorder Alzheimer’s disease (AD) is the accumulation of misfolded tau with abnormal post-translational modifications (PTMs). These include phosphorylation at Threonine 231 (T231) and acetylation at Lysine 274 (K274) and at Lysine 281 (K281). Although tau is recognized to play a central role in pathogenesis of AD, the precise mechanisms by which these abnormal PTMs contribute to the neural toxicity of tau is unclear. Methods Human 0N4R tau (wild type) was expressed in touch receptor neurons of the genetic model organism C. elegans through single-copy gene insertion. Defined mutations were then introduced into the single-copy tau transgene through CRISPR-Cas9 genome editing. These mutations included T231E, to mimic phosphorylation of a commonly observed pathological epitope, and K274/281Q, to mimic disease-associated lysine acetylation – collectively referred as “PTM-mimetics” – as well as a T231A phosphoablation mutant. Stereotypical touch response assays were used to assess behavioral defects in the transgenic strains as a function of age. Genetically-encoded fluorescent biosensors were expressed in touch neurons and used to measure neuronal morphology, mitochondrial morphology, mitophagy, and macro autophagy. Results Unlike existing tau overexpression models, C. elegans single-copy expression of tau did not elicit overt pathological phenotypes at baseline. However, strains expressing disease associated PTM-mimetics (T231E and K274/281Q) exhibited reduced touch sensation and neuronal morphological abnormalities that increased with age. In addition, the PTM-mimetic mutants lacked the ability to engage neuronal mitophagy in response to mitochondrial stress. Conclusions Limiting the expression of tau results in a genetic model where modifications that mimic pathologic tauopathy-associated PTMs contribute to cryptic, stress-inducible phenotypes that evolve with age. These findings and their relationship to mitochondrial stress provides a new perspective into the pathogenic mechanisms underlying AD.

Take a Walk to the Wild Side of Caenorhabditis elegans-Pathogen Interactions

2021 ◽  
Vol 85 (2) ◽  
Author(s):  
Leah J. Radeke ◽  
Michael A. Herman
Keyword(s):  
Innate Immunity ◽  
Caenorhabditis Elegans ◽  
Recent Work ◽  
Genetic Model ◽  
Model Organism ◽  
Bacterial Pathogen ◽  
Content Type ◽  
Microbiome Composition ◽  
C Elegans ◽  
Functional Studies

SUMMARY Microbiomes form intimate functional associations with their hosts. Much has been learned from correlating changes in microbiome composition to host organismal functions. However, in-depth functional studies require the manipulation of microbiome composition coupled with the precise interrogation of organismal physiology—features available in few host study systems. Caenorhabditis elegans has proven to be an excellent genetic model organism to study innate immunity and, more recently, microbiome interactions. The study of C. elegans-pathogen interactions has provided in depth understanding of innate immune pathways, many of which are conserved in other animals. However, many bacteria were chosen for these studies because of their convenience in the lab setting or their implication in human health rather than their native interactions with C. elegans. In their natural environment, C. elegans feed on a variety of bacteria found in rotting organic matter, such as rotting fruits, flowers, and stems. Recent work has begun to characterize the native microbiome and has identified a common set of bacteria found in the microbiome of C. elegans. While some of these bacteria are beneficial to C. elegans health, others are detrimental, leading to a complex, multifaceted understanding of bacterium-nematode interactions. Current research on nematode-bacterium interactions is focused on these native microbiome components, both their interactions with each other and with C. elegans. We will summarize our knowledge of bacterial pathogen-host interactions in C. elegans, as well as recent work on the native microbiome, and explore the incorporation of these bacterium-nematode interactions into studies of innate immunity and pathogenesis.

scholarly journals Recombinant DNA resources for the comparative genomics ofAncylostoma ceylanicum

2016 ◽  
Author(s):  
Wadim J. Kapulkin ◽  
Adriana Magalska ◽  
Ewa Janecka ◽  
Arkadiusz Ciesielski ◽  
Malgorzata Lobocka ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Developmental Stages ◽  
Recombinant Dna ◽  
Genomic Library ◽  
Genetic Model ◽  
Model Organism ◽  
General Interest ◽  
Ancylostoma Ceylanicum ◽  
Free Living ◽  
C Elegans

AbstractWe describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm,Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5‘-linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematodeC. elegansandA. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organismC. elegansand closely related parasitic species. We discuss the potential and relevance ofAncylostoma ceylanicumdata and resources generated by the recombinant DNA approach.

scholarly journals C. elegans expressing D76N β2-microglobulin: a model for in vivo screening of drug candidates targeting amyloidosis

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Giulia Faravelli ◽  
Sara Raimondi ◽  
Loredana Marchese ◽  
Frederick A. Partridge ◽  
Cristina Soria ◽  
...  
Keyword(s):  
Genetic Model ◽  
Model Organism ◽  
Chemical Screening ◽  
C Elegans ◽  
Drug Candidates ◽  
Molecular Events ◽  
Wild Type Phenotype ◽  
Familial Form ◽  
Automated Phenotyping

AbstractThe availability of a genetic model organism with which to study key molecular events underlying amyloidogenesis is crucial for elucidating the mechanism of the disease and the exploration of new therapeutic avenues. The natural human variant of β2-microglobulin (D76N β2-m) is associated with a fatal familial form of systemic amyloidosis. Hitherto, no animal model has been available for studying in vivo the pathogenicity of this protein. We have established a transgenic C. elegans line, expressing the human D76N β2-m variant. Using the INVertebrate Automated Phenotyping Platform (INVAPP) and the algorithm Paragon, we were able to detect growth and motility impairment in D76N β2-m expressing worms. We also demonstrated the specificity of the β2-m variant in determining the pathological phenotype by rescuing the wild type phenotype when β2-m expression was inhibited by RNA interference (RNAi). Using this model, we have confirmed the efficacy of doxycycline, an inhibitor of the aggregation of amyloidogenic proteins, in rescuing the phenotype. In future, this C. elegans model, in conjunction with the INVAPP/Paragon system, offers the prospect of high-throughput chemical screening in the search for new drug candidates.

Characterization of Revertants of unc-93(e1500) in Caenorhabditis elegans Induced by N-ethyl-N-nitrosourea

Genetics ◽  
1997 ◽  
Vol 147 (2) ◽  
pp. 597-608 ◽  
Author(s):  
Elizabeth De Stasio ◽  
Catherine Lephoto ◽  
Lynn Azuma ◽  
Charles Holst ◽  
Dinesh Stanislaus ◽  
...  
Keyword(s):  
Caenorhabditis Elegans ◽  
Protein Function ◽  
Genetic Research ◽  
Rubber Band ◽  
Null Alleles ◽  
Suppressor Genes ◽  
C Elegans ◽  
Intragenic Deletions ◽  
New Gene

Phenotypic reversion of the rubber-band, muscle-defective phenotype conferred by unc-93(e1500) was used to determine the utility of N-ethyl-N-nitrosourea (ENU) as a mutagen for genetic research in Caenorhabditis elegans. In this system, ENU produces revertants at a frequency of 3 × 10–4, equivalent to that of the commonly used mutagen, EMS. The gene identity of 154 ENU-induced revertants shows that the distribution of alleles between three possible suppressor genes differs from that induced by EMS. A higher percentage of revertants are alleles of unc-93 and many fewer are alleles of sup-9 and sup-10. Three revertants complement the three known suppressor genes; they may therefore identify a new gene product(s) involved in this system of excitation-contraction coupling in C. elegans. Molecular characterization of putative unc-93 null alleles reveals that the base changes induced by ENU are quite different from those induced by EMS; specifically we see an increased frequency of A/T → G/C transitions. The frequency of ENU-induced intragenic deletions is found to be 13%. We suggest that ENU, at concentrations below 5 mm, will be a superior mutagen for studies of protein function in C. elegans.

C. elegans models of neuromuscular diseases expedite translational research

2010 ◽  
Vol 1 (3) ◽  
Author(s):  
James Sleigh ◽  
David Sattelle
Keyword(s):  
Large Scale ◽  
Genetic Model ◽  
Muscular Atrophy ◽  
Neuromuscular Disorders ◽  
Neuromuscular Diseases ◽  
Model Organism ◽  
Disease Genes ◽  
Chemical Library ◽  
C Elegans

AbstractThe nematode Caenorhabditis elegans is a genetic model organism and the only animal with a complete nervous system wiring diagram. With only 302 neurons and 95 striated muscle cells, a rich array of mutants with defective locomotion and the facility for individual targeted gene knockdown by RNA interference, it lends itself to the exploration of gene function at nerve muscle junctions. With approximately 60% of human disease genes having a C. elegans homologue, there is growing interest in the deployment of lowcost, high-throughput, drug screens of nematode transgenic and mutant strains mimicking aspects of the pathology of devastating human neuromuscular disorders. Here we explore the contributions already made by C. elegans to our understanding of muscular dystrophies (Duchenne and Becker), spinal muscular atrophy, amyotrophic lateral sclerosis, Friedreich’s ataxia, inclusion body myositis and the prospects for contributions to other neuromuscular disorders. A bottleneck to low-cost, in vivo, large-scale chemical library screening for new candidate therapies has been rapid, automated, behavioural phenotyping. Recent progress in quantifying simple swimming (thrashing) movements is making such screening possible and is expediting the translation of drug candidates towards the clinic.

scholarly journals Health and longevity studies in C. elegans: the “healthy worm database” reveals strengths, weaknesses and gaps of test compound-based studies

2021 ◽  
Vol 22 (2) ◽  
pp. 215-236
Author(s):  
Nadine Saul ◽  
Steffen Möller ◽  
Francesca Cirulli ◽  
Alessandra Berry ◽  
Walter Luyten ◽  
...  
Keyword(s):  
Healthy Aging ◽  
Model Organism ◽  
Research Field ◽  
Aging Research ◽  
Genetic Manipulations ◽  
C Elegans ◽  
Starting Point ◽  
Health Related ◽  
Phenotype Measurement ◽  
Or Gene

AbstractSeveral biogerontology databases exist that focus on genetic or gene expression data linked to health as well as survival, subsequent to compound treatments or genetic manipulations in animal models. However, none of these has yet collected experimental results of compound-related health changes. Since quality of life is often regarded as more valuable than length of life, we aim to fill this gap with the “Healthy Worm Database” (http://healthy-worm-database.eu). Literature describing health-related compound studies in the aging model Caenorhabditis elegans was screened, and data for 440 compounds collected. The database considers 189 publications describing 89 different phenotypes measured in 2995 different conditions. Besides enabling a targeted search for promising compounds for further investigations, this database also offers insights into the research field of studies on healthy aging based on a frequently used model organism. Some weaknesses of C. elegans-based aging studies, like underrepresented phenotypes, especially concerning cognitive functions, as well as the convenience-based use of young worms as the starting point for compound treatment or phenotype measurement are discussed. In conclusion, the database provides an anchor for the search for compounds affecting health, with a link to public databases, and it further highlights some potential shortcomings in current aging research.

Benefits of Using the Invertebrate Model Organism C. Elegans in an Inquiry-Based Laboratory Activity

2021 ◽  
pp. 009862832110296
Author(s):  
Angy J. Kallarackal
Keyword(s):  
American Psychological Association ◽  
Model Organism ◽  
Learning Goals ◽  
Research Skills ◽  
Final Exam ◽  
Laboratory Activity ◽  
Writing Ability ◽  
C Elegans ◽  
Invertebrate Model ◽  
Laboratory Experiences

Background: The goals of laboratory experiences include developing knowledge base, research skills, and scientific communication abilities. Objective: The aim was to assess an inquiry-based laboratory activity using the model organism Caenorhabditis elegans in relation to learning goals. Method: Students in a Biopsychology laboratory course worked in groups to test the effect of various drugs (e.g., nicotine, ethanol, fluoxetine, and melatonin) on C. elegans behavior. The activity included literature review, experimental design, and a final lab report. A cumulative final exam included a synaptic communication question related to the content of the activity. Results: Students showed better retention of laboratory-related content compared to other topics from the course, as demonstrated through performance on the final exam and were able to replicate previous research demonstrating effects of drug on locomotion. However, students did not improve writing ability compared to performance on a previous American Psychological Association style lab report. Conclusion: This study demonstrates that using a student-designed, multi-week laboratory assignment in an undergraduate Biopsychology course supports the growth of psychology knowledge and the development of research skills. Teaching Implications: Instructors should consider using the described laboratory activity for biopsychology or behavioral neuroscience classes or consider similarly designed laboratory formats for other courses in Psychology.

Sign in / Sign up

Export Citation Format

Share Document