scholarly journals Characterization of AG-13, a Newly Reported Anastomosis Group of Rhizoctonia solani

2002 ◽  
Vol 92 (8) ◽  
pp. 893-899 ◽  
Author(s):  
D. E. Carling ◽  
R. E. Baird ◽  
R. D. Gitaitis ◽  
K. A. Brainard ◽  
S. Kuninaga

Rhizoctonia solani anastomosis group (AG)-13 was collected from diseased roots of field grown cotton plants in Georgia in the United States. Isolates of AG-13 did not anastomose with tester isolates of AG-1 through AG-12. Mycelium of all isolates of AG-13 were light brown but darkened as cultures aged. All isolates produced aerial mycelium. Concentric rings were visible after 3 to 4 days of growth but disappeared as cultures aged and darkened. Individual sclerotia were up to 1.5 mm in diameter, similar in color to the mycelium, and generally embedded in the agar. Clumps of sclerotia up to 5 mm in diameter were produced on the agar surface. All attempts to induce basidiospore production were unsuccessful. The 5.8S region of the rDNA from isolates of AG-13 was identical in length and sequence to isolates of all other AGs of R. solani. Length and sequence of the internal transcribed spacer (ITS) regions of rDNA from isolates of AG-13 were unique among AGs of R. solani. Similarity between AG-13 and other AGs of R. solani ranged from 68 to 85% for ITS region 1 and 85 to 95% for ITS region 2. Selected isolates of AG-13 caused minor or no damage to barley, cauliflower, cotton, lettuce, potato, and radish in laboratory or greenhouse studies.

1999 ◽  
Vol 89 (10) ◽  
pp. 942-946 ◽  
Author(s):  
D. E. Carling ◽  
E. J. Pope ◽  
K. A. Brainard ◽  
D. A. Carter

Isolates of Rhizoctonia solani collected from mycorrhizal orchid (Pterostylis acuminata) plants and adjacent leaf litter were characterized. Of 23 selected isolates, 20 were members of a new anastomosis group (AG-12) and the rest were members of AG-6. There were no bridging anastomosis reactions observed between AG-12 and other AGs of R. solani. Among the 20 isolates of AG-12 evaluated, 18 vegetatively compatible populations were detected, indicating diversity within the AG. Mature cultures were dark brown, as were mature sclerotia. Some cultures produced alternating dark- and light-colored concentric rings, with sclerotia forming in the darker rings. Most cultures were appressed to the agar surface. In tests run to characterize pathogenic potential, selected mycorrhizal isolates of AG-12 and AG-6 did little damage to potato and barley seedlings, moderate damage to head lettuce seedlings, and more extensive damage to seedlings of cauliflower and radish. Isolates of AG-12 have not been observed to fruit in nature, and all attempts to induce formation of the teleomorph (Thanatephorus cucumeris) in the laboratory by selected isolates of AG-12 failed.


1998 ◽  
Vol 88 (4) ◽  
pp. 366-371 ◽  
Author(s):  
L. Meyer ◽  
F. C. Wehner ◽  
L. H. Nel ◽  
D. E. Carling

Crater disease (CD) of wheat is caused by a Rhizoctonia solani strain of ambiguous phylogeny. Anastomosis reactions confirmed placement of CD-causing R. solani in anastomosis group (AG) 6, with results indicating a closer affinity to AG-6 GV than to AG-6 HG. Cultures of CD isolates were initially white to cream, turning a yellowish light brown after 10 days. Concentric rings of dark and light mycelium were evident from an early stage. Mycelium generally was appressed to the agar surface, with sparse aerial growth. A few light-colored, irregularly shaped sclerotia could be discerned after 2 weeks. The mean hyphal diameter of CD-causing R. solani was 7.46 μm (ranging from 5.0 to 10.0 μm), and cells contained a mean number of four (ranging from two to eight) nuclei, compared to a mean hyphal diameter of 8.58 and 8.42 μm and a mean nuclear number of six and four for AG-6 HG and AG-6 GV, respectively. The CD isolates had a slower growth rate (15.3 mm/day) than AG-6 HG (29.1 mm/day) and AG-6 GV (22.6 mm/day) but, like AG-6, were thiamine prototrophic. Conspicuous nodulose swellings were produced by CD-causing R. solani on roots of wheat, and infection resulted in retarded shoot growth. Smaller nodules were evident on bean and soybean roots. Fingerprint patterns generated for the various isolates with four enzymes, HpaII, Sau3AI, TaqI, and CfoI, showed the presence of a unique 610-bp fragment in the pathogen. It is proposed that CD-causing R. solani isolates represent a distinct intersterility group within AG-6 that is more related to subgroup GV than to subgroup HG.


2020 ◽  
Vol 46 (4) ◽  
pp. 289-298
Author(s):  
Maria Aurea Saboya Chiaradia Picarelli ◽  
Flavia Rodrigues Alves Patricio ◽  
Ricardo Harakava ◽  
Eliana Borges Rivas ◽  
Addolorata Colariccio

ABSTRACT The use of cultivated grasses in Brazil has grown by 40% between 2010 and 2015, and the species Zoysia japonica Steud, especially the cultivar ‘Esmeralda’, corresponds to 81% of the grass market in the country. The most important disease affecting zoysia grass, known as large patch, is caused by Rhizoctonia solani and occurs in the Brazilian lawns particularly during winter months. The aim of this study was to contribute to the identification and characterization of the anastomosis group of R. solani isolates from lesions typical of large patch collected from ‘Esmeralda’ grass at gardens and golf courses in the states of São Paulo and Bahia, Brazil. All 12 obtained isolates presented dark-brown colonies with aerial mycelial growth, multinucleated hyphae and absence of concentric zonation or sclerotia, and showed their greatest mycelial growth rate at 25°C. In pathogenicity experiments, except three out of R. solani isolates, reduced the growth of zoysia grass. Based on the analysis of sequences of the rDNA-ITS region, the isolates clustered with reference isolates of the anastomosis group AG 2-2 LP. Phylogenetic inference showed that the Brazilian isolates are grouped into two clades that shared the same common ancestral with 96% bootstrap. One of the clades includes only Brazilian isolates while the other one also includes American and Japanese R. solani isolates AG 2-2 LP. This is the first report and characterization of R. solani AG 2-2 LP in zoysiagrass in Brazil.


Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 278-278
Author(s):  
B. E. C. Miranda ◽  
A. M. S. Cardoso ◽  
R. W. Barreto

Rumex acetosa L., common name sorrel (in Brazil, azedinha), is an herb from Europe and Asia commonly used either as a vegetable or a medicinal plant (1). No pathogen has been recorded on this plant species in Brazil, where it has been promoted as an alternative vegetable crop. During a routine inspection of a vegetable garden in the campus of the Universidade Federal de Viçosa (Viçosa, state of Minas Gerais, Brazil) in July 2011, a group of sorrel plants were found bearing blight symptoms. Infected leaves had laminae with soaked irregular necrotic areas and infected petioles had reddish lesions. Healthy leaves touched by neighboring blighted leaves became diseased. A mycelial web was always associated with necrotic tissues. A representative specimen was collected, dried in a plant press, and deposited in the local herbarium (VIC 39063). Pure cultures were obtained through direct transfer of mycelium to PDA plates and deposited in the culture collection at the Universidade Federal de Viçosa – Coleção Oswaldo Almeida Drummond (COAD 1265). Slides containing fungal structures were mounted in lactophenol and observed under a microscope (Olympus BX 51). The fungus had the following morphology: mycelium superficial, either filiform or monilioid and constricted at septae, 6 to 10 μm diameter, often branching at right angles or nearly so, typically bearing a septum at branches near the branching point. Additionally, large, poorly differentiated, dirty white sclerotia were formed in older cultures. When mounted in DAPI, 7-day-old mycelium was seen to bear 5 to 13 nuclei per cell. These characteristics suggested that the fungus was Rhizoctonia solani Kuhn (RS). Anastomosis group (AG) was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS5 and ITS4 (4). A BLAST search revealed that the sequence (GenBank Accession No. KC887353) had 96% sequence identity with RS AG-1-IB GenBank accessions JN426850.1, GU596491.1, JQ692292.1, and JQ692291.1. Pathogenicity of the isolate obtained from sorrel was tested by inoculating four healthy individuals with culture plugs taken from the margin of actively growing cultures on V8 juice agar. Inoculated plants were placed in a dew chamber for 48 h and later transferred to the bench of a greenhouse. Necrosis appeared on all inoculated plants 2 days after inoculation, developing into severe blight after 7 days. RS was isolated from infected tissues. RS AG-1-IB is known as a broad host-range plant pathogen (3). This is its first report as a pathogen of sorrel in Brazil. The sole other published record of this disease on sorrel is from the United States (2). References: (1) N. R. Madeira et al. Hortic. Brasil. 26:428, 2008. (2) G. L. Peltier. Parasitic rhizoctonias in America. University of Illinois Agricultural Experiment Station, 1915. (3) B. Sneh, L. Burpee, and A. Ogoshi. Identification of Rhizoctonia species. APS Press, St Paul, MN, 1991. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.


Plant Disease ◽  
2007 ◽  
Vol 91 (7) ◽  
pp. 865-870 ◽  
Author(s):  
J. W. Hyun ◽  
N. A. Peres ◽  
S.-Y. Yi ◽  
L. W. Timmer ◽  
K. S. Kim ◽  
...  

Two scab pathogens of citrus, Elsinoë fawcettii and E. australis, cause citrus scab and sweet orange scab, respectively, and pathotypes of each species have been described. The two species cannot be readily distinguished by morphological or cultural characteristics and can be distinguished only by host range and the sequence of the internal transcribed spacer (ITS) region. In this study, random amplified polymorphic DNA (RAPD) assays clearly distinguished E. fawcettii and E. australis, and the sweet orange and natsudaidai pathotypes within E. australis also could be differentiated. We developed specific primer sets, Efaw-1 for E. fawcettii; Eaut-1, Eaut-2, Eaut-3, and Eaut-4 for E. australis; and EaNat-1 and EaNat-2 for the natsudaidai pathotype within E. australis using RAPD products unique to each species or pathotype. Other primer sets, Efaw-2 and Eaut-5, which were specific for E. fawcettii and E. australis, respectively, were designed from previously determined ITS sequences. The Efaw-1 and Efaw-2 primer sets successfully identified E. fawcettii isolates from Korea, Australia, and the United States (Florida) and the Eaut-1 to Eaut-5 primer sets identified both the sweet orange pathotype isolates of E. australis from Argentina and the natsudaidai pathotype isolates from Korea. The EaNat-1 and EaNat-2 primer sets were specific for isolates of the natsudaidai pathotype. The Efaw-1 and Efaw-2 primer sets successfully detected E. fawcettii from lesions on diseased leaves and fruit from Korea and primer pairs Eaut-1, Eaut-2, Eaut-3, Eaut-4, and Eaut-5 detected E. australis from lesions on sweet orange fruit from Brazil.


2020 ◽  
Vol 86 (6) ◽  
pp. 457-467
Author(s):  
Tomoo Misawa ◽  
Daisuke Kurose ◽  
Kuniaki Shishido ◽  
Takeshi Toda ◽  
Shiro Kuninaga

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 456-456 ◽  
Author(s):  
G. Mercado Cárdenas ◽  
M. Galván ◽  
V. Barrera ◽  
M. Carmona

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.


Plant Disease ◽  
2012 ◽  
Vol 96 (5) ◽  
pp. 666-672 ◽  
Author(s):  
F. M. Mathew ◽  
R. S. Lamppa ◽  
K. Chittem ◽  
Y. W. Chang ◽  
M. Botschner ◽  
...  

Acreage of dry field pea (Pisum sativum) in North Dakota has increased approximately eightfold from the late 1990s to the late 2000s to over 200,000 ha annually. A coincidental increase in losses to root rots has also been observed. Root rot in dry field pea is commonly caused by a complex of pathogens which included Fusarium spp. and Rhizoctonia solani. R. solani isolates were obtained from roots sampled at the three- to five-node growth stage from North Dakota pea fields and from symptomatic samples received at the Plant Diagnostic Lab at North Dakota State University in 2008 and 2009. Using Bayesian inference and maximum likelihood analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA), 17 R. solani pea isolates were determined to belong to anastomosis group (AG)-4 homogenous group (HG)-II and two isolates to AG-5. Pathogenicity of select pea isolates was determined on field pea and two rotation hosts, soybean and dry bean. All isolates caused disease on all hosts; however, the median disease ratings were higher on green pea, dry bean, and soybean cultivars when inoculated with pea isolate AG-4 HG-II. Identification of R. solani AGs and subgroups on field pea and determination of relative pathogenicity on rotational hosts is important for effective resistance breeding and appropriate rotation strategies.


2001 ◽  
Vol 91 (11) ◽  
pp. 1054-1061 ◽  
Author(s):  
Achmadi Priyatmojo ◽  
Verma E. Escopalao ◽  
Naomi G. Tangonan ◽  
Cecilia B. Pascual ◽  
Haruhisa Suga ◽  
...  

A new foliar disease on coffee leaves was observed in Mindanao, Philippines, in 1996. The symptoms appeared as large circular or irregularly shaped necrotic areas with small circular necrotic spots (1 mm or less in diameter) usually found around the periphery of the large necrotic areas. Rhizoctonia solani was consistently isolated from these diseased coffee leaves. Isolates obtained were multinucleate (3 to 12 nuclei per hyphal cell), had an optimum temperature for hyphal growth at 25°C, prototrophic for thiamine, and anastomosed with tester isolates belonging to R. solani anastomosis group 1 (AG-1). Mature cultures on potato dextrose agar (PDA) were light to dark brown. Sclerotia, light brown to brown, were formed on the surface of PDA and covered the whole mature colony culture. Individual sclerotia often aggregated into large clumps (3 to 8 mm in diameter) and their color was brown to dark brown. In pathogenicity tests, isolates from coffee caused necrotic symptoms on coffee leaves, whereas isolates of AG-1-IA (not isolated from coffee), 1-IB, and 1-IC did not. The results of analyses of restriction fragment length polymorphism of ribosomal DNA internal transcribed spacer, random amplified polymorphism DNA, and fatty acid profiles showed that R. solani isolates from coffee are a population of AG-1 different from AG-1-IA, 1-IB, and 1-IC. These results suggest that R. solani isolates from coffee represent a new subgroup distinct from AG-1-IA, 1-IB, and 1-IC. A new subgroup ID (AG-1-ID) is proposed.


Sign in / Sign up

Export Citation Format

Share Document