scholarly journals Occurrence of Resistance-Breaking Isolates of Rice yellow mottle virus in West and Central Africa

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 259-263 ◽  
Author(s):  
Oumar Traoré ◽  
Agnès Pinel ◽  
Eugénie Hébrard ◽  
Mawena Y. Dieudonné Gumedzoé ◽  
Denis Fargette ◽  
...  
Keyword(s):  
Central Africa ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Serological Tests ◽  
High Frequencies ◽  
Plant Infection ◽  
Resistance Breaking ◽  
West And Central Africa ◽  
Yellow Mottle ◽  
Savannah Zone

Rice yellow mottle virus (RYMV) is the most important rice-infecting virus in Africa. Highly resistant rice (Oryza spp.) cultivars Gigante and Tog5681 were challenged with virus isolates from five countries of the west and central African Sudano-savannah zone in order to investigate the occurrence and prevalence of resistance-breaking (RB) isolates. High resistance was overcome by 38.6% of the isolates. RB isolates could be divided into three main pathogenic groups. Isolates of the first group (17.5%) and of the second group (16.4%) were able to break down the resistance of Gigante only and of Tog5681 only, respectively. Resistance in both cultivars was overcome simultaneously by isolates of the third group (4.7%). In each group, some isolates induced symptoms, whereas plant infection by others was evidenced only by serological tests. RB isolates occurred in all five countries with varying frequencies (19 to 57%). The wide geographical distribution and high frequencies of RB isolates represent a high risk for the durability of resistance to RYMV in the Sudano-savannah zone.

scholarly journals Emergence of a resistance-breaking isolate of Rice yellow mottle virus during serial inoculations is due to a single substitution in the genome-linked viral protein VPg

2006 ◽  
Vol 87 (5) ◽  
pp. 1369-1373 ◽  
Author(s):  
Eugénie Hébrard ◽  
Agnès Pinel-Galzi ◽  
Anne Bersoult ◽  
Christelle Siré ◽  
Denis Fargette
Keyword(s):  
Infectious Clone ◽  
Recessive Gene ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Recessive Resistance ◽  
Nucleotide Polymorphism ◽  
Single Nucleotide ◽  
Resistance Breaking ◽  
The Family ◽  
Yellow Mottle

The recessive gene rymv-1, responsible for the high resistance of Oryza sativa ‘Gigante’ to Rice yellow mottle virus (genus Sobemovirus), was overcome by the variant CI4*, which emerged after serial inoculations of the non-resistance-breaking (nRB) isolate CI4. By comparison of the full-length sequences of CI4 and CI4*, a non-synonymous mutation was identified at position 1729, localized in the putative VPg domain, and an assay was developed based on this single-nucleotide polymorphism. The mutation G1729T was detected as early as the first passage in resistant plants and was found in all subsequent passages. Neither reversion nor any additional mutation was observed. The substitution G1729T, introduced by mutagenesis into the VPg of an nRB infectious clone, was sufficient to induce symptoms in uninoculated leaves of O. sativa ‘Gigante’. This is the first evidence that VPg is a virulence factor in plants with recessive resistance against viruses outside the family Potyviridae.

scholarly journals Rice yellow mottle virus genus Sobemovirus: a continental problem in africa

2010 ◽  
Vol 40 (No. 1) ◽  
pp. 26-36 ◽  
Author(s):  
O.O. Banwo ◽  
M.D. Alegbejo ◽  
M.E. Abo
Keyword(s):  
Management Strategies ◽  
Central Africa ◽  
Mottle Virus ◽  
Future Research ◽  
Limiting Factor ◽  
Rice Yellow Mottle Virus ◽  
Virus Spread ◽  
Yield Losses ◽  
African Countries ◽  
Yellow Mottle

<I>Rice yellow mottle virus</I> genus <I>sobemovirus </I>(RYMV) was first reported in Kenya in 1966. The disease caused by this virus is fast becoming a major limiting factor in the rice production in Africa and neighbouring islands. It is known to occur in eastern, western and southern African countries and, since very recently, in Central Africa. It is transmitted by insect vectors such as <I>Chaectonema </I>spp., <I>Sesselia pusilla</I> Gerst. and <I>Trichispa sericea</I> Guerin (all <I>Coleoptera</I>) and also by mechanical means. About six strains of the virus now exist. Yield losses caused by the virus range from 20 to 100%. Integrated pest management has been suggested to minimise damage caused by this disease to rice. This paper reviews the characteristics of the virus, symptomatology, host range, distribution, strains, transmission, vector dynamics and virus spread, the economic importance, and management strategies. The need of future research of RYMV is also highlighted.

scholarly journals Serological, molecular and phylogenetic analysis of Rice Yellow Mottle Virus (RYMV) isolates collected in Southern-Benin

2021 ◽  
Vol 8 (6) ◽  
pp. 224-236
Author(s):  
Issaka Souley ◽  
◽  
Bachabi Louisiane ◽  
Naroua Illiassou ◽  
Basso Adamou ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Central Africa ◽  
Viral Disease ◽  
Mottle Virus ◽  
Economic Losses ◽  
Rice Yellow Mottle Virus ◽  
The West ◽  
African Lineage ◽  
Yellow Mottle ◽  
Southern Benin

The rice yellow mottle is the best known viral disease of rice in Africa. It causes significant economic losses in farmer’s fields. The serological properties of Rice Yellow Mottle Virus (RYMV) isolates, collected in Southern Benin, were assessed by immunological tests with polyclonal and monoclonal antibodies (Pabs and MAbs). The isolates CP (Capsid protein) portions, obtained by RT-PCR, were sequenced and their amino-acids sequences were analyzed and used for phylogenetic analysis. Three different RYMV pathogenic groups, including three resistance breaking (RB) isolates (Be20, Be21 and Be27) which over came allele rymv1-5gene, were identified. Two serotypes Ser1/strain S1 and Ser2/ strain S2 were also distinguished. The molecular properties of the isolates CP gene and the phylogenetic characteristics indicated that the Southern Benin RYMV strain is heterogeneous. The strain S1-Benin linked to the West Central African lineage(S1-WCA) is related to strain from Togo and Niger, whereas, the strain S2 Benin is the stumps of the West African lineage (S1-WA) and is related to Mali, Burkina Faso and Ivory Coast RYMV strains. These results reported the virus pathogenicity level and showed the relationships between RYMV strains in all Dahomey gap countries and in West and Central Africa. Keywords: serotypes, RYMV strains, RB isolates and phylogenetic analysis

scholarly journals First Report and Characterization of Rice yellow mottle virus in Central Africa

Plant Disease ◽  
2001 ◽  
Vol 85 (8) ◽  
pp. 920-920 ◽  
Author(s):  
O. Traoré ◽  
A. Pinel ◽  
D. Fargette ◽  
G. Konaté
Keyword(s):  
West Africa ◽  
Phylogenetic Analyses ◽  
Central Africa ◽  
Sister Group ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Cultivated Rice ◽  
Wild Rice Species ◽  
Field Samples ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is the main virus infecting rice (Oryza sativa) in Africa. First reported in Kenya (East Africa), RYMV was later found in most countries of East and West Africa where rice is grown, and in Madagascar in the Indian Ocean. In Central Africa however, the disease had never been reported in rice fields. Ninety-eight field samples with typical yellow mottle symptoms from cultivated rice and two wild rice species (Oryza longistaminata and O. barthii) were collected in the Soudano-Sahelian zones, in the north of Cameroon and the south of Chad (Central Africa) in September 2000. RYMV was detected by ELISA with polyclonal antisera (1) in all samples. All virus isolates were also mechanically transmitted to rice cv. BG 90-2, which is highly susceptible to RYMV. Tests with monoclonal antibodies showed that most isolates from Central Africa were of the SI serotype, which is widespread in the Soudano-Sahelian zones of West Africa (1). The coat protein gene of 7 isolates was amplified by RT-PCR and the expected 720 bp fragment was obtained. Resulting sequences (AJ306735, AJ317949, AJ317950, AJ317951, AJ317952, AJ317953, AJ317954) shared over 95% sequence identity. They were compared to a set of sequences of RYMV isolates from cultivated rice of different geographical origins (2). Phylogenetic analyses by maximum parsimony (PAUP 4) showed that isolates from Central Africa belonged to a monophyletic group, a sister group of West African isolates from the Soudano-Sahelian zones, further supporting the geographic basis of RYMV diversity (2). RYMV incidence was generally less than 10% but reached 20% in some irrigated plots in the two countries. References: (1) G. Konaté et al. Arch Virol. 142:1117, 1997. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.

scholarly journals Phylogeography of Rice yellow mottle virus in Africa

2003 ◽  
Vol 84 (3) ◽  
pp. 733-743 ◽  
Author(s):  
Zakia Abubakar ◽  
Fadhila Ali ◽  
Agnes Pinel ◽  
Oumar Traoré ◽  
Placide N'Guessan ◽  
...  
Keyword(s):  
East Africa ◽  
Central Africa ◽  
Genetic Distances ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
African Countries ◽  
West Central ◽  
Wide Range ◽  
Geographical Distances ◽  
Yellow Mottle

The sequences of the coat protein gene of a representative sample of 40 isolates of Rice yellow mottle virus (RYMV) from 11 African countries were analysed. The overall level of nucleotide diversity was high ( ∼14 %). Great geographical distances between the sites where isolates were collected were consistently associated with high genetic distances. In contrast, a wide range of genetic distances occurred among isolates spread over short geographical distances. There was no evidence of long-range dispersal. RYMV diversity in relation to land area was eight times greater in East Africa than in West/Central Africa. West/Central African isolates with up to 9 % divergence belonged to a monophyletic group, whereas the East African isolates with up to 13 % divergence fell into distantly related groups. In East Africa, each Tanzanian strain had a specific and restricted geographical range, whereas West/Central African strains had large and partially overlapping geographical distributions. Overall, our results suggest an earlier RYMV diversification in East Africa and a later radiation in West/Central Africa. The West African situation was consistent with virus adaptation to savanna, forest and other ecological conditions. In contrast East Africa, as exemplified by the Tanzanian situation, with numerous physical barriers (mountain chains, sea channel, lakes), suggested that RYMV strains resulted from divergence under isolated conditions. For RYMV and for two other viruses, phylogenetic relationships were established between isolates from Madagascar and isolates from the Lake Victoria region.

scholarly journals Occurrence of rice yellow mottle virus resistance breaking isolates in lowland catchment zones of Uganda

1970 ◽  
Vol 29 (3) ◽  
pp. 383-400
Author(s):  
I. Ramathani ◽  
S.B. Mukasa ◽  
T. Alicai ◽  
S. Nanyiti ◽  
J. Lamo
Keyword(s):  
Virus Disease ◽  
Lowland Rice ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rice Yellow Mottle Virus ◽  
Symptom Development ◽  
Rt Pcr ◽  
Resistance Breaking ◽  
Catchment Areas ◽  
Yellow Mottle

Rice (Oryza spp; 2n=24.) production in Uganda and Africa in general, is seriously threatened by the Rice yellow mottle virus disease (RYMVD), a disease caused by Rice yellow mottle virus (RYMV) within the genus Sobemovirus; family Sobemoviridae. This study investigated the existence and distribution of resistance-breaking RYMV pathotype in the three major lowland rice catchment areas in Uganda. Four known rice accessions resistant to Rice yellow mottle virus (RYMV) namely; Gigante, Tog5672, Tog5674 and Tog5681, carrying resistant allele’s rymv1-2, rymv1-4 & RYMV3, rymv1-5 and rymv1-3, respectively, were tested for their response to different RYMV isolates. The isolates were collected from three major lowland rice catchment areas of Doho, Kibimba, and Olweny in Uganda. Out of 100 leaf samples collected from the field and assayed for RYMV and confirmed to be positive using RT-PCR, 83 isolates induced symptoms on IR64- the RYMV susceptible line. Seventy-seven (92.8%) isolates were able to overcome resistance in at least one of the four differential rice accessions, as confirmed by the presence of RYMV symptoms; while 6 (7.2%) isolates were asymptomatic. Variation in time (days) for symptom development post-inoculation (dpi) and AUDPC were observed. Symptoms appeared within 5-7 days on IR64; while it took on average 11, 18, 36, and 18 days to appear on Gigante, Tog5672, Tog5674 and Tog5681, respectively. The highest AUDPC was observed on IR64 (254.7); while the lowest was observed on Tog5681 (74.1). Two major patho-groups were observed; those that broke down resistance in Gigante only (25.3%) and Gigante & Tog5672 (33.7%). Five isolates from Doho (Budaka & Bugiri districts) and Kibimba (Butaleja district) catchment areas broke down RYMV resistance in three accessions i.e. (Tog5681, Gigante & Tog5672) and (Tog5674, Gigante & Tog5672), respectively. Resistance breaking isolates were confirmed in all  the three sampled catchment zones, however, Doho and Kibimba had some unique isolates that broke down resistance in accessions carrying resistance allele rymv 1-3 and rymv1-5 in addition to rymv1-2. Results from this study showed that RYMV isolates in Uganda can break down resistance conferred by the rymv1-2 resistance gene allele. However, accessions Tog5681 and Tog5674 seem to hold stable RYMV resistance and, thus are recommended for RYMV breeding.

scholarly journals First Report of Rice yellow mottle virus in Rice in the Central African Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 162-162 ◽  
Author(s):  
D. R. S. Longué ◽  
A. Galzi-Pinel ◽  
S. Semballa ◽  
I. Zinga ◽  
D. Fargette ◽  
...  
Keyword(s):  
Central African Republic ◽  
Disease Incidence ◽  
Central Africa ◽  
Rice Production ◽  
Mottle Virus ◽  
Cultivated Plants ◽  
Rice Yellow Mottle Virus ◽  
Rt Pcr ◽  
Serotype 1 ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.

scholarly journals Identification of a Hypervirulent Pathotype of Rice yellow mottle virus: A Threat to Genetic Resistance Deployment in West-Central Africa

2018 ◽  
Vol 108 (2) ◽  
pp. 299-307 ◽  
Author(s):  
Eugénie Hébrard ◽  
Agnès Pinel-Galzi ◽  
Aderonke Oludare ◽  
Nils Poulicard ◽  
Jamel Aribi ◽  
...  
Keyword(s):  
High Resistance ◽  
Infectious Clone ◽  
Genetic Resistance ◽  
Central Africa ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
West Central ◽  
Adaptive Processes ◽  
Resistance Breakdown ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV) causes high losses to rice production in Africa. Several sources of varietal high resistance are available but the emergence of virulent pathotypes that are able to overcome one or two resistance alleles can sometimes occur. Both resistance spectra and viral adaptability have to be taken into account to develop sustainable rice breeding strategies against RYMV. In this study, we extended previous resistance spectrum analyses by testing the rymv1-4 and rymv1-5 alleles that are carried by the rice accessions Tog5438 and Tog5674, respectively, against isolates that are representative of RYMV genetic and pathogenic diversity. Our study revealed a hypervirulent pathotype, named thereafter pathotype T′, that is able to overcome all known sources of high resistance. This pathotype, which is spatially localized in West-Central Africa, appears to be more abundant than previously suspected. To better understand the adaptive processes of pathotype T′, molecular determinants of resistance breakdown were identified via Sanger sequencing and validated through directed mutagenesis of an infectious clone. These analyses confirmed the key role of convergent nonsynonymous substitutions in the central part of the viral genome-linked protein to overcome RYMV1-mediated resistance. In addition, deep-sequencing analyses revealed that resistance breakdown does not always coincide with fixed mutations. Actually, virulence mutations that are present in a small proportion of the virus population can be sufficient for resistance breakdown. Considering the spatial distribution of RYMV strains in Africa and their ability to overcome the RYMV resistance genes and alleles, we established a resistance-breaking risk map to optimize strategies for the deployment of sustainable and resistant rice lines in Africa.

Sign in / Sign up

Export Citation Format

Share Document