scholarly journals An ancient adenosine receptor gains olfactory function in bony vertebrates

2021 ◽  
Author(s):  
Daniel Kowatschew ◽  
Sigrun I Korsching
Keyword(s):  
Adenosine Receptor ◽  
Olfactory Receptor ◽  
Receptor Gene ◽  
Sister Group ◽  
Olfactory Function ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Double Labeling ◽  
Most Recent Common Ancestor ◽  
Aquatic Vertebrates

Abstract Nucleotides are an important class of odorants for aquatic vertebrates such as frogs and fishes, but also have manifold signalling roles in other cellular processes. Recently, an adenosine receptor believed to belong to the adora2 clade has been identified as an olfactory receptor in zebrafish. Here we set out to elucidate the evolutionary history of both this gene and its olfactory function. We have performed a thorough phylogenetic study in vertebrates, chordates and their sister group, ambulacraria, and show that the origin of the zebrafish olfactory receptor gene can be traced back to the most recent common ancestor of all three groups as a segregate sister clade (adorb) to the adora gene family. Eel, carp, and clawed frog all express adorb in a sparse and distributed pattern within their olfactory epithelium very similar to the pattern observed for zebrafish, i.e. consistent with a function as olfactory receptor. In sharp contrast, lamprey adorb-expressing cells are absent from the sensory region of the lamprey nose, but form a contiguous domain directly adjacent to the sensory region. Double-labeling experiments confirmed the expression of lamprey adorb in nonneuronal cells and are consistent with an expression in neuronal progenitor cells. Thus, adorb may have undergone a switch of function in the jawed lineage of vertebrates towards a role as olfactory receptor.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

2021 ◽  
Author(s):  
Handong Wang ◽  
Ye Chen ◽  
Wei Shi ◽  
Yongyao Guo ◽  
Jinghong He ◽  
...  
Keyword(s):  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Sister Group ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Mitochondrial Genomes ◽  
Evolutionary Analysis ◽  
Habitat Distribution ◽  
Remarkable Feature ◽  
Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

scholarly journals Three Complete Mitochondrial Genomes of Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis (Insecta: Phasmatodea) and Their Phylogeny

Insects ◽  
2021 ◽  
Vol 12 (9) ◽  
pp. 779 ◽  
Author(s):  
Ke-Ke Xu ◽  
Qing-Ping Chen ◽  
Sam Pedro Galilee Ayivi ◽  
Jia-Yin Guan ◽  
Kenneth B. Storey ◽  
...  
Keyword(s):  
Sister Group ◽  
Recent Common Ancestor ◽  
Mitochondrial Genomes ◽  
Sister Group Relationship ◽  
Protein Coding ◽  
Most Recent Common Ancestor ◽  
Stick Insects ◽  
Long Time ◽  
Relationship Of ◽  
Complete Mitochondrial Genomes

Insects of the order Phasmatodea are mainly distributed in the tropics and subtropics and are best known for their remarkable camouflage as plants. In this study, we sequenced three complete mitochondrial genomes from three different families: Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis. The lengths of the three mitochondrial genomes were 15,896 bp, 16,869 bp, and 17,005 bp, respectively, and the gene composition and structure of the three stick insects were identical to those of the most recent common ancestor of insects. The phylogenetic relationships among stick insects have been chaotic for a long time. In order to discuss the intra- and inter-ordinal relationship of Phasmatodea, we used the 13 protein-coding genes (PCGs) of 85 species for maximum likelihood (ML) and Bayesian inference (BI) analyses. Results showed that the internal topological structure of Phasmatodea had a few differences in both ML and BI trees and long-branch attraction (LBA) appeared between Embioptera and Zoraptera, which led to a non-monophyletic Phasmatodea. Consequently, after removal of the Embioptera and Zoraptera species, we re-performed ML and BI analyses with the remaining 81 species, which showed identical topology except for the position of Tectarchus ovobessus (Phasmatodea). We recovered the monophyly of Phasmatodea and the sister-group relationship between Phasmatodea and Mantophasmatodea. Our analyses also recovered the monophyly of Heteropterygidae and the paraphyly of Diapheromeridae, Phasmatidae, Lonchodidae, Lonchodinae, and Clitumninae. In this study, Peruphasma schultei (Pseudophasmatidae), Phraortes sp. YW-2014 (Lonchodidae), and species of Diapheromeridae clustered into the clade of Phasmatidae. Within Heteropterygidae, O. guangxiensis was the sister clade to O. mouhotii belonging to Dataminae, and the relationship of (Heteropteryginae + (Dataminae + Obriminae)) was recovered.

Early-diverging bumblebees from across the roof of the world: the high-mountain subgenus Mendacibombus revised from species’ gene coalescents and morphology (Hymenoptera, Apidae)

Zootaxa ◽  
2016 ◽  
Vol 4204 (1) ◽  
pp. 1 ◽  
Author(s):  
PAUL H. WILLIAMS ◽  
JIAXING HUANG ◽  
PIERRE RASMONT ◽  
JIANDONG AN
Keyword(s):  
Incomplete Lineage Sorting ◽  
Sister Group ◽  
Process Models ◽  
Coi Gene ◽  
Colour Pattern ◽  
Recent Common Ancestor ◽  
High Mountain ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
Colour Patterns

The bumblebees of the subgenus Mendacibombus of the genus Bombus are the sister group to all other extant bumblebees and are unusual among bees for specialising in some of the highest elevation habitats with entomophilous plants on Earth. Most named taxa in this group (24 available names, from a total of 49 published names) were described originally from small differences in the colour pattern of the hair, many as parts (e.g. subspecies) of just one species. Subsequent taxonomic treatments recognised multiple species, but have described very few morphological characters, most of which are in the male genitalia. We examined 4413 specimens representing all of the named taxa from throughout the group’s global range to describe variation in DNA, in skeletal morphology, and in the colour patterns of the hair. Using Bayesian inference of the phylogeny from an evolutionary model for the fast-evolving COI gene, and fitting either general mixed Yule/coalescent models or Poisson tree process models, we identify COI gene coalescents, which are expected to characterise species as evolutionarily independent lineages. None of the conditions most likely to compromise this interpretation (biased sampling, paralogy, introgression, heteroplasmy, incomplete lineage sorting) appears to be a substantial problem in this case. In an integrative analysis, we show that colour patterns are often variable within these groups and do not diagnose the same groups as we recognise from genes; in contrast, the groups recognised from gene coalescents can also be diagnosed from differences we identify in morphology. We infer that the 12 groups with coalescents in the COI gene that are corroborated by morphology constitute species, whereas many of these species are polymorphic in colour pattern. Lectotypes are designated for 15 taxa in order to reduce uncertainty in the identity and application of the names. We provide new morphological keys and distribution maps for the species. Then we use four genes (fast-evolving mitochondrial COI and 16S; and slower nuclear PEPCK and opsin) to obtain an absolute chronogram of phylogenetic relationships among the species. From published estimates that the most recent common ancestor of the subgenus Mendacibombus diverged from the other bumblebees at the beginning of the Oligocene, our results support the crown group of Mendacibombus as having diversified in the late Miocene, events that both appear to have been associated with periods of climate cooling. Relative conservatism in the alpine/subalpine climate niche of Mendacibombus, as compared with the much more diversified climate niches in the sister group of all other bumblebees, may have contributed to constraining the number of Mendacibombus species to just one twentieth of the total number of extant bumblebee species. 

scholarly journals The evolutionary history of Stomatopoda (Crustacea: Malacostraca) inferred from molecular data

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3844 ◽  
Author(s):  
Cara Van Der Wal ◽  
Shane T. Ahyong ◽  
Simon Y.W. Ho ◽  
Nathan Lo
Keyword(s):  
Phylogenetic Analyses ◽  
Sister Group ◽  
Molecular Data ◽  
Recent Common Ancestor ◽  
Ancestral State ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
History Of ◽  
The Tropics ◽  
Age Constraints

The crustacean order Stomatopoda comprises seven superfamilies of mantis shrimps, found in coastal waters of the tropics and subtropics. These marine carnivores bear notable raptorial appendages for smashing or spearing prey. We investigated the evolutionary relationships among stomatopods using phylogenetic analyses of three mitochondrial and two nuclear markers. Our analyses recovered the superfamily Gonodactyloidea as polyphyletic, withHemisquillaas the sister group to all other extant stomatopods. A relaxed molecular clock, calibrated by seven fossil-based age constraints, was used to date the origin and major diversification events of stomatopods. Our estimates suggest that crown-group stomatopods (Unipeltata) diverged from their closest crustacean relatives about 340 Ma (95% CRI [401–313 Ma]). We found that the specialized smashing appendage arose after the spearing appendage ∼126 Ma (95% CRI [174–87 Ma]). Ancestral state reconstructions revealed that the most recent common ancestor of extant stomatopods had eyes with six midband rows of hexagonal ommatidia. Hexagonal ommatidia are interpreted as plesiomorphic in stomatopods, and this is consistent with the malacostracan ground-plan. Our study provides insight into the evolutionary timescale and systematics of Stomatopoda, although further work is required to resolve with confidence the phylogenetic relationships among its superfamilies.

scholarly journals First phylogenetic analysis of dengue virus serotype 4 circulating in Espírito Santo state, Brazil, in 2013 and 2014

2017 ◽  
Vol 146 (1) ◽  
pp. 100-106 ◽  
Author(s):  
C. R. VICENTE ◽  
C. S. PANNUTI ◽  
P. R. URBANO ◽  
A. C. FELIX ◽  
C. CERUTTI JUNIOR ◽  
...  
Keyword(s):  
Dengue Virus ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Envelope Gene ◽  
Mato Grosso ◽  
Espírito Santo ◽  
Most Recent Common Ancestor ◽  
Virus Serotype ◽  
Espirito Santo ◽  
Genotype Ii

SUMMARYThe purpose of the present study was to reconstruct the phylogeny of dengue virus serotype 4 (DENV-4) that was circulating in Espírito Santo state, Brazil, in 2013 and 2014, and to discuss the epidemiological implications associated with this evolutionary hypothesis. Partial envelope gene of eight DENV-4 samples from Espírito Santo state were sequenced and aligned with 72 worldwide DENV-4 reference sequences from GenBank. A phylogenetic tree was reconstructed through Bayesian Inference and the Time of the Most Recent Common Ancestor was estimated. The study detected the circulation of DENV-4 genotype II in Espírito Santo state, which was closely related to strains from the states of Mato Grosso collected in 2012 and of São Paulo sampled in 2015. This cluster emerged around 2011, approximately 4 years after the entry of the genotype II in Brazil through its northern states, possibly imported from Venezuela and Colombia. This is so far the first phylogenetic study of the DENV-4 circulating in Espírito Santo state and shows the importance of an internal route of dengue viral circulation in Brazil to the introduction of the virus into this state.

scholarly journals Corrigendum to: Phylogeny and biogeography of the ant subfamily Myrmeciinae (Hymenoptera : Formicidae)

2003 ◽  
Vol 17 (4) ◽  
pp. 605 ◽  
Author(s):  
Philip S. Ward ◽  
Seán G. Brady
Keyword(s):  
Sequence Data ◽  
Strong Support ◽  
Sister Group ◽  
Molecular Data ◽  
Morphological Data ◽  
Recent Common Ancestor ◽  
Bootstrap Support ◽  
Data Set ◽  
Molecular Sequence Data ◽  
Most Recent Common Ancestor

We investigated phylogenetic relationships among the 'primitive' Australian ant genera Myrmecia and Nothomyrmecia (stat. rev.) and the Baltic amber fossil genus Prionomyrmex, using a combination of morphological and molecular data. Outgroups for the analysis included representatives from a variety of potential sister-groups, including five extant subfamilies of ants and one extinct group (Sphecomyrminae). Parsimony analysis of the morphological data provides strong support (~95% bootstrap proportions) for the monophyly of (1) genus Myrmecia, (2) genus Prionomyrmex, and (3) a clade containing those two genera plus Nothomyrmecia. A group comprising Nothomyrmecia and Prionomyrmex is also upheld (85% bootstrap support). Molecular sequence data (~2200 base pairs from the 18S and 28S ribosomal RNA genes) corroborate these findings for extant taxa, with Myrmecia and Nothomyrmecia appearing as sister-groups with ~100% bootstrap support under parsimony, neighbour-joining and maximum-likelihood analyses. Neither the molecular nor the morphological data set allows us to identify unambiguously the sister-group of (Myrmecia + (Nothomyrmecia + Prionomyrmex)). Rather, Myrmecia and relatives are part of an unresolved polytomy that encompasses most of the ant subfamilies. Taken as a whole, our results support the contention that many of the major lineages of ants – including a clade that later came to contain Myrmecia, Nothomyrmecia and Prionomyrmex – arose at around the same time during a bout of diversification in the middle or late Cretaceous. On the basis of Bayesian dating analysis, the estimated age of the most recent common ancestor of Myrmecia and Nothomyrmecia is 74 million years (95% confidence limits, 53–101�million years), a result consistent with the origin of the myrmeciine stem lineage in the Cretaceous. The ant subfamily Myrmeciinae is redefined to contain two tribes, Myrmeciini (genus Myrmecia) and Prionomyrmecini (Nothomyrmecia and Prionomyrmex). Phylogenetic analysis of the enigmatic Argentine fossils Ameghinoia and Polanskiella demonstrates that they are also members of the Myrmeciinae, probably more closely related to Prionomyrmecini than to Myrmeciini. Thus, the myrmeciine ants appear to be a formerly widespread group that retained many ancestral formicid characteristics and that became extinct everywhere except in the Australian region.

scholarly journals Discovery of a glowing millipede in California and the gradual evolution of bioluminescence in Diplopoda

2015 ◽  
Vol 112 (20) ◽  
pp. 6419-6424 ◽  
Author(s):  
Paul E. Marek ◽  
Wendy Moore
Keyword(s):  
Molecular Phylogenetics ◽  
Light Emission ◽  
Sister Group ◽  
High Elevation ◽  
Recent Common Ancestor ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
Gradual Evolution ◽  
Directional Change ◽  
Repeated Evolution

The rediscovery of the Californian millipede Xystocheir bistipita surprisingly reveals that the species is bioluminescent. Using molecular phylogenetics, we show that X. bistipita is the evolutionary sister group of Motyxia, the only genus of New World bioluminescent millipedes. We demonstrate that bioluminescence originated in the group’s most recent common ancestor and evolved by gradual, directional change through diversification. Because bioluminescence in Motyxia has been experimentally demonstrated to be aposematic, forewarning of the animal’s cyanide-based toxins, these results are contrary to aposematic theory and empirical evidence that a warning pattern cannot evolve gradually in unpalatable prey. However, gradual evolution of a warning pattern is plausible if faint light emission served another function and was co-opted as an aposematic signal later in the diversification of the genus. Luminescence in Motyxia stem-group taxa may have initially evolved to cope with reactive oxygen stress triggered by a hot, dry environment and was repurposed for aposematism by high-elevation crown-group taxa colonizing new habitats with varying levels of predation. The discovery of bioluminescence in X. bistipita and its pivotal phylogenetic location provides insight into the independent and repeated evolution of bioluminescence across the tree of life.

scholarly journals Rates of evolution in the Carnivora (Mammalia): the importance of phylogeny and fossils

1992 ◽  
Vol 6 ◽  
pp. 100-100
Author(s):  
John J. Flynn
Keyword(s):  
Molecular Evolution ◽  
Molecular Clock ◽  
Divergence Time ◽  
Sister Group ◽  
Late Eocene ◽  
Recent Common Ancestor ◽  
Most Recent Common Ancestor ◽  
Higher Taxa ◽  
Rates Of Evolution ◽  
Molecular Divergence

Calculations of “rates of evolution” have been applied to a variety of indicators of change within populations, species, or higher taxa. This has led to confusion about taxonomic and temporal scaling, particularly when rates are calculated for supposedly “equivalent” taxonomic ranks, or “higher-level” taxa that are not monophyletic groups. All calculations of rates of evolutionary change require accurate temporal calibration. Even in studies of molecular evolution that assume a “molecular clock”, the rate at which any clock ticks must be calibrated empirically by fossil data on the age of divergence of some taxa.Molecular clock rates for all Mammalia generally have been calculated from the primate fossil record and phylogeny. However, rates of molecular evolution have been shown to vary both within and among different clades. Given a preference for a more rigorous system in which molecular divergence is not assumed to occur at a constant rate, the time of divergence should be determined directly for all clades in studies of molecular “rates of evolution”.The mammalian order Carnivora is a monophyletic group widely cited in studies of evolutionary tempo, and mode. However, few of those rate studies have considered explicitly the roles of fossil taxa and rigorously tested phylogenies. For example, phylogenetic placement of early Cenozoic Carnivora (generally placed in the paraphyletic “stem-group” “Miacoidea”), relative to the two major clades of living Carnivora (Caniformia and Feliformia), profoundly influences estimates of the age of cladogenetic divergence for clades of living carnivorans. If all the taxa placed within the “Miacoidea” lie outside a restricted clade of Carnivora (defined as the most recent common ancestor of extant Carnivora, and all of its descendants), then the oldest Carnivora (“neocarnivorans”) are late Eocene (about 35–40 Ma). However, if miacid “miacoids” are caniforms and viverravid “miacoids” are feliforms, then the Caniformia/Feliformia (=Carnivora) clade is at least as old as the oldest “miacoid” (middle Paleocene, or >60 Ma). The implications for calculations of rates of evolution within Carnivora are obvious. Similarly, many fossil Carnivora taxa have been assigned to living families, although the phylogenetic relationships of both fossil and living taxa within most of these families has been poorly understood. This presentation will consider: 1) minimum estimates of clade divergence time, based on current hypotheses of carnivoran phylogeny (emphasizing placement of fossil taxa) and oldest occurrence of fossils within a clade or its sister group- traditional taxonomies both underestimate (e.g. Caniformia/Feliformia) and overestimate (e.g. some living families, such as Viverridae) clade divergence times; and 2) calculation of rates of evolution within Carnivora, focusing on taxonomic diversification and molecular divergence, comparison of rates calculated using traditional taxonomies and artificial “higher-taxa” categories versus those using phylogenetic clades (“unranked”), and the effects of fossil taxa.

scholarly journals Olfactory function in the trace amine-associated receptor family (TAARs) evolved twice independently

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Milan Dieris ◽  
Daniel Kowatschew ◽  
Sigrun I. Korsching
Keyword(s):  
Olfactory Receptor ◽  
Olfactory Receptors ◽  
Large Family ◽  
Bony Fish ◽  
Recent Common Ancestor ◽  
Late Gene ◽  
Ancestral Gene ◽  
Most Recent Common Ancestor ◽  
Serotonergic Receptor ◽  
Receptor Family

AbstractOlfactory receptor families have arisen independently several times during evolution. The origin of taar genes, one of the four major vertebrate olfactory receptor families, is disputed. We performed a phylogenetic analysis making use of 96 recently available genomes, and report that olfactory functionality has arisen twice independently within the TAAR family, once in jawed and once in jawless fish. In lamprey, an ancestral gene expanded to generate a large family of olfactory receptors, while the sister gene in jawed vertebrates did not expand and is not expressed in olfactory sensory neurons. Both clades do not exhibit the defining TAAR motif, and we suggest naming them taar-like receptors (tarl). We have identified the evolutionary origin of both taar and tarl genes in a duplication of the serotonergic receptor 4 that occurred in the most recent common ancestor of vertebrates. We infer two ancestral genes in bony fish (TAAR12, TAAR13) which gave rise to the complete repertoire of mammalian olfactory taar genes and to class II of the taar repertoire of teleost fish. We follow their evolution in seventy-one bony fish genomes and report a high evolutionary dynamic, with many late gene birth events and both early and late gene death events.

scholarly journals Affinities and class-level systematics of the phylum Cnidaria

1992 ◽  
Vol 6 ◽  
pp. 297-297
Author(s):  
Heyo Van Iten
Keyword(s):  
Phylogenetic Relationships ◽  
Common Ancestor ◽  
Prey Capture ◽  
Soft Part ◽  
Sister Group ◽  
Monophyletic Group ◽  
Recent Common Ancestor ◽  
Single Pair ◽  
Most Recent Common Ancestor ◽  
Alternative Hypotheses

Phylogenetic relationships among the cnidarian classes Anthozoa, Hydrozoa and Scyphozoa, and between Cnidaria and other metazoan phyla, continue to be subject to widely divergent interpretations. Also controversial are the affinities of numerous fossil groups, including Byronia Bischoff, Sphenothallus Hall and conulariids, that have been interpreted as extinct cnidarians. Currently favored interpretations of evolution within Cnidaria are generally consistent with one of two alternative hypotheses of phylogenetic relationships: scyphozoans and anthozoans are members of a monophylclic group that excludes hydrozoans; or scyphozoans and hydrozoans are members of a monophyletic group that excludes anthozoans. Putative anthozoan-scyphozoan synapomorphies include (1) gastric septa present; (2) cnidae present in both ectoderm and gastroderm; (3) sex cells gastrodermal; and (4) mesoglea contains amoeboid cells. Putative hydrozoan-scyphozoan synapomorphies include (1) medusa present; (2) tetraradial symmetry; (3) rhopaloid nematocysts; and (4) similarities in sperm structure.Evaluation of alternative hypotheses of relationships within Cnidaria is complicated by uncertainty surrounding relationships between this and other metazoan phyla. While some investigators have interpreted Cnidaria and Ctenophora as members of a monophyletic group that excludes other phyla, others have argued that ctenophorans are more closely related to platyhelminths than they are to cnidarians. Putative cnidarian-ctenophoran synapomorphies include (1) production of cells modified for prey capture; and (2) presence of a medusa. Putative ctenophoran-platyhelminth synapomorphies include (1) presence of gonoducts; (2) ciliated cells with several to many cilia; (3) determinate cleavage; and (4) muscle cells developed from mesoderm. Comparisons of these and other phyla indicate that the strongest hypotheses of synapomorphy are those between cnidarians and ctenophorans. Ctenophorans do not have a mesoderm, and they lack complex reproductive structures that can be homologized with platyhelminth gonoducts. Similarities between ctenophorans and platyhelminths in ciliation and cleavage type are either non-homologous or shared primitive. The most recent common ancestor of ctenophorans and cnidarians was probably a medusa-like animal with circular and meridional muscle fibers and a non-septate digestive cavity having four radial canals. This cavity probably lacked cells specialized for prey capture, but glutinant prey-capture structures may have been present on tentacles. Sperm produced by this common ancestor were most similar to sperm of extant ctenophorans, hydrozoans and scyphozoans. Anatomical features unique to ctenophorans or cnidarians, regarded by some investigators as evidence against a close relationship between these two groups, are autapomorphies. These interpretations imply that putative hydrozoan-scyphozoan synapomorphies are actually shared primitive, and that the presence of gastric septa and cnidae-bearing gastric filaments in scyphozoans and anthozoans is shared derived. This would mean that the most parsimonious hypothesis of phylogenetic relationships within Cnidaria is that anthozoans and scyphozoans are members of a monophyletic group that excludes hydrozoans.Debate over relationships among these extant taxa has heightened interest in the affinities of prominent groups of problematic fossil cnidarians. Byronia Bischoff, Sphenothallus Hall and conulariids, all characterized by an apatitic, multilamellar theca, show detailed anatomical similarities to hydrozoans and/or scyphozoans. Putative synapomorphies linking Byronia and coronatid scyphozoans include the presence of multiple whorls of thorn-like nodes projecting into the thecal cavity, with each whorl consisting of eight nodes arranged in two sets of four nodes each. Sphenothallus, characterized by a pair of tentacles and, in some species, multiple branching, is most similar to hydrozoan and scyphozoan polyps, many of which are colonial or exhibit a single pair of tentacles early in their development. Similarities in hard- and soft-part anatomy between scyphozoans and conulariids suggest that conulariids, like scyphozoans, possessed four gastric septa and produced medusae through polydisc strobilation. Although conulariids have been interpreted as ancestral to extant cnidarians, they are more likely either a sister group to Scyphozoa or members of this class.

Sign in / Sign up

Export Citation Format

Share Document