scholarly journals Unravelling the enigma of cortical tremor and other forms of cortical myoclonus

Brain ◽  
2020 ◽  
Vol 143 (9) ◽  
pp. 2653-2663 ◽  
Author(s):  
Anna Latorre ◽  
Lorenzo Rocchi ◽  
Francesca Magrinelli ◽  
Eoin Mulroy ◽  
Alfredo Berardelli ◽  
...  
Keyword(s):  
Essential Role ◽  
Autosomal Dominant ◽  
Common Denominator ◽  
Cortical Myoclonus ◽  
Inhibitory Mechanisms ◽  
Wide Range ◽  
Genetic Features ◽  
Repeat Expansions ◽  
Rhythmic Oscillation ◽  
Hallmark Feature

Abstract Cortical tremor is a fine rhythmic oscillation involving distal upper limbs, linked to increased sensorimotor cortex excitability, as seen in cortical myoclonus. Cortical tremor is the hallmark feature of autosomal dominant familial cortical myoclonic tremor and epilepsy (FCMTE), a syndrome not yet officially recognized and characterized by clinical and genetic heterogeneity. Non-coding repeat expansions in different genes have been recently recognized to play an essential role in its pathogenesis. Cortical tremor is considered a rhythmic variant of cortical myoclonus and is part of the ‘spectrum of cortical myoclonus’, i.e. a wide range of clinical motor phenomena, from reflex myoclonus to myoclonic epilepsy, caused by abnormal sensorimotor cortical discharges. The aim of this update is to provide a detailed analysis of the mechanisms defining cortical tremor, as seen in FCMTE. After reviewing the clinical and genetic features of FCMTE, we discuss the possible mechanisms generating the distinct elements of the cortical myoclonus spectrum, and how cortical tremor fits into it. We propose that the spectrum is due to the evolution from a spatially limited focus of excitability to recruitment of more complex mechanisms capable of sustaining repetitive activity, overcoming inhibitory mechanisms that restrict excitatory bursts, and engaging wide areas of cortex. Finally, we provide evidence for a possible common denominator of the elements of the spectrum, i.e. the cerebellum, and discuss its role in FCMTE, according to recent genetic findings.

scholarly journals Genetic Differentiation in Anthocyanin Content among Berry Fruits

2021 ◽  
Vol 43 (1) ◽  
pp. 36-51
Author(s):  
Alicja Ponder ◽  
Ewelina Hallmann ◽  
Martyna Kwolek ◽  
Dominika Średnicka-Tober ◽  
Renata Kazimierczak
Keyword(s):  
Essential Role ◽  
Positive Impact ◽  
Skin Pigmentation ◽  
Highbush Blueberry ◽  
Anthocyanin Content ◽  
Healthy Nutrition ◽  
Wide Range ◽  
Health Promoting ◽  
Berry Fruits ◽  
Red Currant

Anthocyanins are widely distributed secondary metabolites that play an essential role in skin pigmentation of many plant organs and microorganisms. Anthocyanins have been associated with a wide range of biological and pharmacological properties. They are also effective agents in the prevention and treatment of many chronic diseases. Berries are particularly abundant in these compounds; therefore, their dietary intake has health-promoting effects. The aim of this study was to identify and determine the anthocyanin content in selected species and cultivars of berry fruits, such as raspberry, blackberry, red currant, blackcurrant, and highbush blueberry, widely consumed by Europeans. The concentrations of anthocyanins were determined by HPLC, identifying individual compounds: cyanidin-3-O-glucoside, pelargonidin-3-O-glucoside, delphinidin-3-O-glucoside, delphinidin-3-O-rutinoside, cyanidin-3-O-rutinoside, delphinidin-3-O-galactoside, cyanidin-3-O-galactoside, and malvidin-3-O-galactoside. The experimental data showed that the selected species and cultivars of berry fruits differ significantly in the contents of anthocyanins. Among all species tested, blackberry and blackcurrant were characterized significantly by the highest content of anthocyanins (sum), while the lowest content was found in red currant fruits. Additionally, the content of individual anthocyanin compounds in particular species and cultivars was also different. Considering the high content of anthocyanins and their potential positive impact on human health and protection against disease, berries should be part of healthy nutrition.

CADASIL Syndrome: A Genetic Form of Vascular Dementia

1998 ◽  
Vol 11 (2) ◽  
pp. 71-77 ◽  
Author(s):  
Stephen Salloway ◽  
Joseph Hong
Keyword(s):  
Vascular Dementia ◽  
Autosomal Dominant ◽  
Microvascular Disease ◽  
The Elderly ◽  
Dominant Form ◽  
Genetic Features ◽  
Autosomal Dominant Form ◽  
Family Gene ◽  
Cerebral Arteriopathy ◽  
Genetic Form

Mental disorders due to cerebral microvascular disease have been known for over 100 years. Recently, an autosomal dominant form of cerebral arteriopathy (CADASIL) has been described in association with a Notch3 family gene on the short arm of chromosome 19. CADASIL causes subcortical lacunar infarction and dementia in over 80% of cases and depression in a large proportion of patients. Clinically, CADASIL may appear to be very similar to hypertensive microvascular disease (Binswanger's disease), a condition that is seen in the elderly. This article reviews the clinical, pathologic, and genetic features of CADASIL. CADASIL is of interest to neurologists and psychiatrists because it is the first syndrome of vascular dementia and depression with an identified gene. How the gene causes the widespread arteriopathy is not yet known. Insights gained from the study of CADASIL should help us better understand its etiology, as well as the options for treatment of the more common forms of microvascular disease seen in the elderly.

scholarly journals Twenty-five years since the identification of the first SCA gene: history, clinical features and perspectives for SCA1

2018 ◽  
Vol 76 (8) ◽  
pp. 555-562 ◽  
Author(s):  
Carlos Roberto Martins Junior ◽  
Fabrício Castro de Borba ◽  
Alberto Rolim Muro Martinez ◽  
Thiago Junqueira Ribeiro de Rezende ◽  
Iscia Lopes Cendes ◽  
...  
Keyword(s):  
Clinical Features ◽  
Autosomal Dominant ◽  
Trinucleotide Repeat ◽  
Point Of View ◽  
Spinocerebellar Ataxias ◽  
Coding Region ◽  
The Past ◽  
Monogenic Diseases ◽  
Repeat Expansions ◽  
Core Features

ABSTRACT Spinocerebellar ataxias (SCA) are a clinically and genetically heterogeneous group of monogenic diseases that share ataxia and autosomal dominant inheritance as the core features. An important proportion of SCAs are caused by CAG trinucleotide repeat expansions in the coding region of different genes. In addition to genetic heterogeneity, clinical features transcend motor symptoms, including cognitive, electrophysiological and imaging aspects. Despite all the progress in the past 25 years, the mechanisms that determine how neuronal death is mediated by these unstable expansions are still unclear. The aim of this article is to review, from an historical point of view, the first CAG-related ataxia to be genetically described: SCA 1.

Inherited Ataxias

2015 ◽  
Author(s):  
Susan Perlman
Keyword(s):  
Autosomal Recessive ◽  
Autosomal Dominant ◽  
Friedreich Ataxia ◽  
Spinocerebellar Ataxias ◽  
Recessive Ataxia ◽  
Internet Resources ◽  
Genetic Abnormalities ◽  
Repeat Expansions ◽  
The Common ◽  
Inherited Ataxias

The inherited ataxias are disorders that cause progressive imbalance as a result of pathology in the cerebellum and its various connecting pathways. Autosomal recessive ataxias include Friedreich ataxia, ataxia with isolated vitamin E deficiency, ataxia-telangiectasia, and autosomal recessive ataxia of Charlevoix-Saguenay, among others. A discussion of autosomal dominant ataxias covers spinocerebellar ataxias (SCA) types 1 through 14, dentatorubral pallidoluysian atrophy (DRPLA), and episodic ataxia (EA) syndromes. Clinical features, laboratory studies, differential diagnosis, and management of inherited ataxias are discussed. Tables describe both autosomal recessive ataxias and autosomal dominant ataxias (with known gene loci), childhood– or young adult–onset ataxias with ill-defined genetic abnormalities, phenotypic features that may indicate a specific genotype in the common autosomal dominant ataxias, and normal and expanded ranges of various repetitive nucleotide sequences in inherited ataxias. Figures include a diagrammatic representation of the type of repeat expansions associated with ataxias, aggregates of ataxin 3, a schematic of some of the proposed pathogenic mechanisms in the polyglutamine ataxias, and dystonia in a patient with SCA3. A sidebar offers selected Internet resources for information on ataxias. This chapter contains 64 references.

Music Onset Detection

2010 ◽  
pp. 297-316
Author(s):  
Ruohua Zhou ◽  
Josh D Reiss
Keyword(s):  
Performance Measures ◽  
Essential Role ◽  
General Scheme ◽  
Future Research ◽  
Onset Detection ◽  
Time Frequency ◽  
Detection Algorithms ◽  
Music Signal ◽  
Wide Range ◽  
Future Research Directions

Music onset detection plays an essential role in music signal processing and has a wide range of applications. This chapter provides a step by step introduction to the design of music onset detection algorithms. The general scheme and commonly-used time-frequency analysis for onset detection are introduced. Many methods are reviewed, and some typical energy-based, phase-based, pitch-based and supervised learning methods are described in detail. The commonly used performance measures, onset annotation software, public database and evaluation methods are introduced. The performance difference between energy-based and pitch-based method is discussed. The future research directions for music onset detection are also described.

359 A NONINVASIVE APPROACH TO DIAGNOSE TRANSGENIC CONCEPTI DURING PREGNANCY IN GOATS

2015 ◽  
Vol 27 (1) ◽  
pp. 268
Author(s):  
K. C. S. Tavares ◽  
C. R. Lazzarotto ◽  
C. M. Calderon ◽  
L. T. Martins ◽  
S. G. Neto ◽  
...  
Keyword(s):  
Mammalian Species ◽  
Proteinase K ◽  
The Road ◽  
Phenol Extraction ◽  
Cell Free Fetal Dna ◽  
Wide Range ◽  
Genetic Features ◽  
Pcr Products ◽  
Dna Precipitation ◽  
Primer Sets

The discovery of cell-free fetal DNA (cffDNA) circulating in the blood of pregnant women, and more recently in cows, ewes, and mares, paves the road towards the development of molecular tools to explore genetic features of embryos and/or fetuses before term. Albeit a wide range of analyses are in current use and development in humans, genetic diagnostic targets other than sex determination are still not described for other mammalian species. The aim of this study was to detect cffDNA from transgenic goat concepti for the human lysozyme (hLZ) gene in the blood of nontransgenic dams. Blood was collected from 3 nontransgenic goats carrying hLZ-transgenic concepti on Days 40–50, 80–90, and 110–120 of gestation. Also, blood was drawn 8 and 12 days after parturition from two other nontransgenic goats that delivered hLZ-transgenic offspring. Blood samples (10 mL) were spun at 1200 rpm for 10 min; resulting serum or plasma were stored at –20°C (serum) or 4°C (plasma). The DNA was extracted by mixing 350 µL of serum or plasma with an equal volume of TE buffer and 5 µL of proteinase K (20 mg mL–1). The mixtures were incubated at 55°C for 3 h, followed by phenol extraction and DNA precipitation by sodium acetate and 100% ethanol, with further incubation at –20°C overnight and centrifugation at 12 000 × g for 10 min. The DNA pellets were washed with 70% ethanol and eluted in 20 µL of ultrapure water. For the PCR, primer sets for the hLZ transgene (hLZ-i1-F 5′ CGGTCCAGGGCAAGGTCTTTGA 3′ and hLZ-i1-R 5′ ACTGCTCCTGGGGTTTTGCC 3′) and for GAPDH as the endogenous control were used. Reactions contained 3 µL of DNA, 200 nM of each primer, and 45 µL of PCR Mastermix (Quatro G Pesquisa & Desenvolvimento, Porto Alegre, Brazil). The DNA from serum and plasma of nontransgenic goats were used as negative controls. The cycling conditions were 95°C for 10 min, followed by 55 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s, plus a final extension at 72°C for 10 min. The PCR products were analysed by electrophoresis in 2% agarose gel. As expected, GAPDH was amplified in most of the samples (12/13). The 200-bp PCR product corresponding to hLZ was detected in the dam's serum in all 3 gestational phases, with 2 out of 3 animals being positive on 40 to 50 and 80 to 90 days, and all 3 on 110 to 120 days of pregnancy. Furthermore, the transgene was amplified from dam's plasma in all samples after parturition. Only GAPDH amplification was detected in the blood of nontransgenic goats. These results suggest that cffDNA is present in the goat's blood circulation at the fetal phase during pregnancy and at least during the first 2 weeks after parturition. This method can be safely applied as a useful tool in zygote-DNA microinjection experiments, providing an early and preterm diagnostic of transgenic concepti through the dam's blood.Research was supported by FINEP.

scholarly journals Inflammatory profile dysregulation in nuclear workers occupationally exposed to low-dose gamma radiation

2019 ◽  
Vol 60 (6) ◽  
pp. 768-779 ◽  
Author(s):  
Nevena Aneva ◽  
Elena Zaharieva ◽  
Olya Katsarska ◽  
Gergana Savova ◽  
Katia Stankova ◽  
...  
Keyword(s):  
Gamma Radiation ◽  
Blood Plasma ◽  
Antioxidant Status ◽  
Colorimetric Assay ◽  
Nuclear Industry ◽  
Tissue Response ◽  
Common Denominator ◽  
Monocyte Chemoattractant Protein 1 ◽  
Wide Range ◽  
Occupationally Exposed

ABSTRACT Chronic inflammation is a common denominator linking a wide range of health conditions, including tissue response to radiation exposure. This pilot study investigates whether inflammatory cytokines—interleukins IL-6, −8, −10, monocyte chemoattractant protein-1 (MCP-1) and tumor necrosis factor α (TNFα)—can be used as early biomarkers of radiation-induced adverse health effects in occupationally exposed individuals. The study included 33 workers externally exposed to gamma radiation from the nuclear industry with cumulated doses from 0.11 to 190 mSv and 42 non-exposed controls of comparable age and socio-economic status. IL-6, IL-8, MCP-1, TNFα and IL-10 were analyzed by enzyme-linked assay (ELISA) in blood plasma samples. Total antioxidant status (TAS) of blood plasma was determined by a colorimetric assay. The radiation-exposed and control groups measured significantly different levels of MCP-1, TNFα and IL-10. Seventy-five percent of radiation workers had either high MCP-1 levels or low IL-10 levels and 30% had all three cytokines dysregulated. Approximately 50% of workers showed upregulated antioxidant status, which appeared to compensate the pro-inflammatory cytokine shift in these individuals. In contrast, only 2% of the control subjects were found to have three dysregulated cytokines, and all of them measured within the normal TAS range. The present study may represent an important step towards the establishment of a reliable set of biomarkers for health-risk estimation in population cohorts exposed to low radiation doses.

Genecological variation in recently established populations of Abutilon theophrasti (velvetleaf)

1986 ◽  
Vol 64 (8) ◽  
pp. 1632-1643 ◽  
Author(s):  
S. I. Warwick ◽  
L. D. Black
Keyword(s):  
Life History ◽  
Local Environment ◽  
Allozyme Variation ◽  
Morphological Characters ◽  
Abutilon Theophrasti ◽  
Population Differences ◽  
Weed Species ◽  
Wide Range ◽  
Genetic Features ◽  
Multilocus Associations

Life history and electrophoretic variation were examined in 39 populations of Abutilon theophrasti L., velvetleaf, collected from southern Ohio (39° N) to central Ontario (45° N). These collections represent a climatic gradient at the northern extreme of the distribution range of this weed species in North America. Plants from each of the 39 populations were grown from seed in a standard garden trial. A total of 51 growth, germination, and morphological characters were measured for each population. Significant among-population differences (p < 0.05) were found for 33 of the 51 characters. Many of these population differences were correlated with latitude and climate. These patterns of variation may well represent the first stages of differentiation in response to local environment. Of particular importance was the wide range of differences among populations in proportions of seeds exhibiting dormancy. Results from an electrophoretic survey of 16 enzyme systems provided evidence for very low levels of allozyme variation among the 39 populations of A. theophrasti. Only two enzymes were variable and only four multi-locus electrophoretic genotypes were evident among the 39 populations. Velvetleaf exhibited a number of genetic features characteristic of successful colonizers: high levels of fixed heterozygosity as a result of polyploidy, multilocus associations providing a reduced number of genotypes, and high levels of population differentiation in morphometric and life-history traits.

Sign in / Sign up

Export Citation Format

Share Document