A New Flora of the Southeastern United StatesFlora of the Southeastern United States being Descriptions of the Seed- Plants, Ferns, and Fern-Allies Growing Naturally in North Carolina, South Carolina, Georgia, Florida, Tennessee, Alabama, Mississippi, Arkansas, Louisiana, and the Indian Territory and in Oklahoma and Texas East of the One Hundredth Meridian. J. K. Small

1903 ◽  
Vol 37 (443) ◽  
pp. 810-811
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Southeastern United States ◽  
Seed Plants ◽  
Indian Territory ◽  
The One

Distribution of an Invasive Weevil, Pseudocneorhinus bifasciatus Roelofs, in the Southeastern United States

2005 ◽  
Vol 40 (1) ◽  
pp. 25-30 ◽  
Author(s):  
A. G. Wheeler ◽  
David W. Boyd
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
North America ◽  
Southeastern United States ◽  
Ornamental Plants ◽  
Review Of The Literature ◽  
Northeastern United States

The twobanded Japanese weevil, Pseudocneorhinus bifasciatus Roelofs, first found in North America near Philadelphia, PA, in 1914, is better known in the northeastern United States than in the Southeast. Based on examination of specimens in 11 museums, fieldwork, and review of the literature, we document the presence of this pest of ornamental plants in Alabama (3 counties), Georgia (12), North Carolina (16), and South Carolina (19). The southeastern distribution is mapped, and locality and date are provided for the first collection in each state: North Carolina, 1955; Georgia, 1956; South Carolina, 1966; and Alabama, 1970.

scholarly journals Southeastern Tomato Growers Adopt Integrated Pest Management

1998 ◽  
Vol 8 (1) ◽  
pp. 40-44 ◽  
Author(s):  
Ellen M. Bauske ◽  
Geoffrey M. Zehnder ◽  
Edward J. Sikora ◽  
Joseph Kemble
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Integrated Pest Management ◽  
Pest Management ◽  
Government Regulation ◽  
Tomato Fruit ◽  
Southeastern United States ◽  
Fresh Market ◽  
Production Problems

Multidisciplinary integrated pest management (IPM) teams from seven states in the southeastern United States (Alabama, North Florida, Georgia, Kentucky, North Carolina, South Carolina, and Tennessee) met to develop standards for adopting IPM in fresh-market tomato (Lycopersicon esculentum L.) production. Teams were composed of growers, private consultants, extension personnel, and faculty. IPM practices available for use on tomatoes in the southeastern United States were identified and a survey to assess the current level of adoption of IPM practices was developed. The survey also allowed growers to identify insect, disease, and production problems; beneficial technology and research developments; and other information relevant to IPM adoption. In northern Florida, Georgia, Kentucky, North Carolina, and South Carolina, IPM adoption by tomato growers was classified as medium or high on >75% of the fresh-market tomato acreage surveyed. It appears these states may have met the federal mandate for IPM adoption. Tomato producers listed early blight, late blight, bacterial spot, bacterial speck, and bacterial wilt as the main disease problems; tomato fruit worm, thrips, and aphids as the primary insect problems; and poor weather conditions, government regulation, and labor as their primary production problems. Twenty-six percent of the producers throughout the region felt that the development of insect- and disease-resistant varieties would be most helpful to increase production.

scholarly journals Increased Occurrence of Target Spot of Soybean Caused by Corynespora cassiicola in the Southeastern United States

Plant Disease ◽  
2006 ◽  
Vol 90 (7) ◽  
pp. 974-974 ◽  
Author(s):  
S. R. Koenning ◽  
T. C. Creswell ◽  
E. J. Dunphy ◽  
E. J. Sikora ◽  
J. D. Mueller
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Microscopic Examination ◽  
Southeastern United States ◽  
Corynespora Cassiicola ◽  
Susceptible Host ◽  
The North ◽  
Target Spot ◽  
Soybean Plants

Target spot of soybean (Glycine max (L.) Merr.) caused by Corynespora cassiicola (Berk. & Curt.), although found in most soybean-growing countries, is considered to be a disease of limited importance (1) and has never been reported to cause soybean yield loss in the southeastern United States (2,3). Soybean plants submitted to the North Carolina Plant Disease and Insect Clinic (NCPDIC) in August 2004 from Beaufort, Robeson, Wilson, and Johnston counties, NC had symptoms consistent with target spot. Symptoms consisted of roughly circular, necrotic leaf lesions from minute to 11 mm in diameter, though typically approximately 4 to 5 mm in diameter, and with a yellow margin. Large lesions occasionally exhibited a zonate pattern often associated with this disease. Microscopic examination of the lesions revealed the presence of spores (conidia) typical of C. cassiicola (1). Conidia were mostly three to five septate with a central hilum at the base and ranged in size from 7 to 22 wide × 39 to 520 μm long. Three commercial soybean fields near Blackville, SC (Barnwell County) were severely affected by this disease and it caused premature defoliation. Nineteen of twenty-seven maturity group VII and VIII genotypes in the 2004 Clemson University soybean variety trial near Blackville, SC had visible symptoms of target spot. Heavy rainfall associated with hurricanes during September 2004 probably enhanced the incidence of this disease, and yield suppression due to target spot was estimated at 20 to 40% in some fields. In 2005, 20 of 161 soybean samples submitted to the NCPDIC or collected in surveys from 16 counties were positive for target spot on the basis of microscopic examination. Target spot also was diagnosed in six counties (Baldwin, DeKalb, Elmore, Fayette, Macon, and Pickens) in Alabama and in four additional counties (Bamberg, Hampton, Orange-burg, and Calhoun) in South Carolina in 2005. Records from the NCPDIC indicate that target spot had not been diagnosed on soybean in North Carolina since 1981. The large increase in incidence of target spot in the southeast may be related to changes in weather patterns, changes in pathogen virulence, and/or the introduction of more susceptible host genotypes. References: (1) J. B. Sinclair. Target spot. Page 27 in: Compendium of Soybean Diseases. G. L. Hartman et al. eds. The American Phytopathological Society, St. Paul, MN, 1999. (2) J. A. Wrather et al. Plant Dis. 79:1076. 1995. (3) J. A. Wrather et al. On-line publication. doi:10.1094/PHP-2003-0325-01-RV. Plant Health Progress, 2003.

scholarly journals First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States

Plant Disease ◽  
2009 ◽  
Vol 93 (4) ◽  
pp. 432-432 ◽  
Author(s):  
I. E. Tzanetakis ◽  
T. L. Guzmán-Baeny ◽  
Z. P. VanEsbroeck ◽  
G. E. Fernandez ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Southeastern United States ◽  
Yellow Vein ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Reverse Transcription Pcr

Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic ‘Apache’ blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5′ GATCTGTCCTGGGATTGTTC 3′) and INSVR (5′ GTCTCCTTCTGGTTCTATAATCAT 3′) that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.

scholarly journals Scheduling Collard Planting Dates Regionally to Lengthen the Production Period

1992 ◽  
Vol 2 (1) ◽  
pp. 64-66
Author(s):  
Robert J. Dufault ◽  
K. Dean Batal ◽  
Dennis Decoteau ◽  
J. Thomas Garrett ◽  
Darbie Granberry ◽  
...  
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Southeastern United States ◽  
Planting Dates ◽  
Single Location ◽  
Production Period

The experiment screened two spring and two fall planting dates in six regions within North Carolina, South Carolina, and Georgia. The objective was to extend the production over the southeastern United States rather than at a single location. Spring harvests lasted from mid-April to early July. Summer-to-winter harvests lasted from mid-August to late January. Collards were not harvested in any of the locations from late January to mid-April or from early July to mid-August. More extensive planting dates may further increase the longevity of production.

Sign in / Sign up

Export Citation Format

Share Document