scholarly journals A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor β

2007 ◽  
Vol 283 (4) ◽  
pp. 2275-2285 ◽  
Author(s):  
Pia Bagamasbad ◽  
Kembra L. Howdeshell ◽  
Laurent M. Sachs ◽  
Barbara A. Demeneix ◽  
Robert J. Denver
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

scholarly journals Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽  
2006 ◽  
Vol 147 (9) ◽  
pp. 4292-4302 ◽  
Author(s):  
Koshi Hashimoto ◽  
Masanobu Yamada ◽  
Shunichi Matsumoto ◽  
Tsuyoshi Monden ◽  
Teturou Satoh ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Retinoid X Receptor ◽  
Mrna Levels ◽  
Response Element ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

scholarly journals Thyroid hormone receptor β mutations in the ‘hot-spot region’ are rare events in thyroid carcinomas

2007 ◽  
Vol 192 (1) ◽  
pp. 83-86 ◽  
Author(s):  
Ana Sofia Rocha ◽  
Ricardo Marques ◽  
Inês Bento ◽  
Ricardo Soares ◽  
João Magalhães ◽  
...  
Keyword(s):  
Thyroid Cancer ◽  
Thyroid Hormone ◽  
Transgenic Mice ◽  
Cell Lines ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Hot Spot ◽  
Direct Sequencing ◽  
Human Thyroid ◽  
Thyroid Hormone Receptor Β

Thyroid cancer constitutes the most frequent endocrine neoplasia. Targeted expression of rearranged during transfection (RET)/papillary thyroid carcinoma (PTC) and V600E V-raf murine sarcoma viral oncogene homolog B1 (BRAF) to the thyroid glands of transgenic mice results in tumours similar to those of human PTC, providing evidence for the involvement of these oncogenes in PTC. Kato et al. developed a mouse model that mimics the full spectrum of the human follicular form of thyroid cancer (FTC). FTC rapidly develops in these mice through introduction of the thyroid hormone receptor β (THRB)PV mutant on the background of the inactivated THRB wt locus. Our aim was to verify if, in the context of human follicular thyroid carcinogenesis, THRB acted as a tumour suppressor gene. We screened for mutations of the THRB gene in the hot-spot region, spanning exons 7–10, in 51 thyroid tumours and six thyroid cancer cell lines by PCR and direct sequencing. We did not find mutations in any of the tumours or cell lines analysed. Our findings suggest that, in contrast to the findings on the THRB-mutant transgenic mice, THRB gene mutations are not a relevant mechanism for human thyroid carcinogenesis.

A Novel Point Mutation of Thyroid Hormone Receptor β Gene in a Family with Resistance to Thyroid Hormone

Thyroid ◽  
1997 ◽  
Vol 7 (5) ◽  
pp. 771-773 ◽  
Author(s):  
TOMOHISA NAGASHIMA ◽  
HIDEKI YAGI ◽  
KANJI NAGASHIMA ◽  
AKIHIRO SAKURAI ◽  
KAZUMICHI ONIGATA ◽  
...  
Keyword(s):  
Thyroid Hormone ◽  
Point Mutation ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Resistance To Thyroid Hormone ◽  
Thyroid Hormone Receptor Β

scholarly journals Oncogenic mutations of thyroid hormone receptor β

Oncotarget ◽  
2015 ◽  
Vol 6 (10) ◽  
pp. 8115-8131 ◽  
Author(s):  
Jeong Won Park ◽  
Li Zhao ◽  
Mark Willingham ◽  
Sheue-yann Cheng
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Oncogenic Mutations ◽  
Thyroid Hormone Receptor Β

scholarly journals In Vivo Activity of the Thyroid Hormone Receptor β- and α-Selective Agonists GC-24 and CO23 on Rat Liver, Heart, and Brain

Endocrinology ◽  
2011 ◽  
Vol 152 (3) ◽  
pp. 1136-1142 ◽  
Author(s):  
Carmen Grijota-Martínez ◽  
Eric Samarut ◽  
Thomas S. Scanlan ◽  
Beatriz Morte ◽  
Juan Bernal
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Target Genes ◽  
Thyroid Hormone Receptor ◽  
Receptor Subtype ◽  
Receptor Subtypes ◽  
Genetic Modifications ◽  
Hormone Analogs ◽  
Thyroid Hormone Receptor Β

Thyroid hormone analogs with selective actions through specific thyroid hormone receptor (TR) subtypes are of great interest. They might offer the possibility of mimicking physiological actions of thyroid hormone with receptor subtype or tissue specificity with therapeutic aims. They are also pharmacological tools to dissect biochemical pathways mediated by specific receptor subtypes, in a complementary way to mouse genetic modifications. In this work, we studied the in vivo activity in developing rats of two thyroid hormone agonists, the TRβ-selective GC-24 and the TRα-selective CO23. Our principal goal was to check whether these compounds were active in the rat brain. Analog activity was assessed by measuring the expression of thyroid hormone target genes in liver, heart, and brain, after administration to hypothyroid rats. GC-24 was very selective for TRβ and lacked activity on the brain. On the other hand, CO23 was active in liver, heart, and brain on genes regulated by either TRα or TRβ. This compound, previously shown to be TRα-selective in tadpoles, displayed no selectivity in the rat in vivo.

Sign in / Sign up

Export Citation Format

Share Document