36 Transgenic Somatic Cell Nuclear Transfer Blastocyst Selection with Embryo Biopsying

2018 ◽  
Vol 30 (1) ◽  
pp. 157
Author(s):  
M. Nõmm ◽  
M. Ivask ◽  
P. Pärn ◽  
Ü. Jaakma ◽  
S. Kõks
Keyword(s):  
Somatic Cell ◽  
Cell Line ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Expression Vector ◽  
Fibroblast Cell ◽  
Fibroblast Cell Line ◽  
Pcr Product ◽  
Verification Methods ◽  
Passage Number

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.93%), of which 12 (54.54%) were TG positive blastocysts and selected for transfer. Our hFSH TG fibroblast cell line demonstrated a low concentration of TG cells in its culture, despite the selection and verification methods applied. Based on the analysis of SCNT embryos, only 54.54% of the embryos developed were TG positive. The embryo biopsying technique enables us to use only TG-positive SCNT cloned embryos for transfer, therefore avoiding non-TG pregnancies. This study was supported by Enterprise Estonia grant EU30020, Institutional research funding IUT 8-1 and Horizon 2020 Project SEARMET 692299.

Fibroblast cell line establishment, cryopreservation and interspecies embryos reconstruction in red panda (Ailurus fulgens)

Zygote ◽  
2009 ◽  
Vol 17 (2) ◽  
pp. 117-124 ◽  
Author(s):  
Yong Tao ◽  
Jianming Liu ◽  
Yunhai Zhang ◽  
Meiling Zhang ◽  
Junshun Fang ◽  
...  
Keyword(s):  
Somatic Cell ◽  
Cell Line ◽  
Fibroblast Cell ◽  
Basic Medium ◽  
Fibroblast Cell Line ◽  
Cell Line Establishment ◽  
Red Panda ◽  
Fetal Bovine ◽  
Ailurus Fulgens

SummaryIn evolution, the red panda (Ailurus fulgens) plays a pivotal role in the higher level phylogeny of arctoides carnivore mammals. The red panda inhabits certain Asian countries only and its numbers are decreasing. Therefore, the development of feasible ways to preserve this species is necessary. Genetic resource cryopreservation and somatic cell nuclear transfer (SCNT) have been used extensively to rescue this endangered species. The present study describes the establishment, for the first time, of a red panda ear fibroblast cell line, which was then cryopreserved, thawed and cultured. Through micromanipulation, interspecies embryos were reconstructed using the cryopreserved–thawed fibroblasts of the red panda as the donor and rabbit oocytes as recipients. A total of 194 enucleated rabbit oocytes were reconstructed with red panda ear fibroblasts; enucleated oocytes were activated without fusion as the control. The results show that the fibroblast cell line was established successfully by tissue culture and then cryopreserved in liquid nitrogen. Supplementation with 20% fetal bovine serum and 8% dimethyl sulphoxide in basic medium facilitated the cryopreservation. The interspecies embryos were successfully reconstructed. The cleavage, morulae and blastocyst rates after in vitro culture were 71, 47 and 23% (31/194), respectively. This study indicated that a somatic cell line could be established and cryopreserved from red panda and that rabbit cytoplast supports mitotic cleavage of the red panda karyoplasts and is capable of reprogramming the nucleus to achieve blastocysts.

Transcriptional Drug Repositioning Improves Development Of Somatic Cell Nuclear Transfer Embryos Via Inhibition Of CDK4/6 And Cyclin D1 During First Cleavage of Bovine Pseudo-Zygotes

2021 ◽  
Author(s):  
Paria Behdarvandiyan ◽  
Sayedeh Sahar Hosseini ◽  
Farnoosh Jafarpour ◽  
Mehdi Hajian ◽  
Morteza Hosseini ◽  
...  
Keyword(s):  
Small Molecules ◽  
Somatic Cell ◽  
Cyclin D1 ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Drug Repositioning ◽  
Fibroblast Cell ◽  
Developmental Competence ◽  
Cleavage Rate ◽  
First Time

Abstract Since the birth of the first cloned sheep, ‘Dolly’, Somatic Cell Nuclear Transfer (SCNT) has become a powerful method in the fields of agricultural and biomedical research. However, due to the accumulation of errors during nuclear reprogramming, the efficiency of this technique remained low. In this study, we applied a transcriptional drug repositioning approach for selecting small molecules to improve SCNT efficiency. This involved identifying a blueprint signature of differentially expressed genes in SCNT embryos compared to IVF embryos and finding compounds that target those genes effectively. As a result of the analysis, two highly ranked compounds, namely the breast cancer treatment Palbociclib and the retinoid derivative Fenretinide, were selected which are selective inhibitor of the cyclin-dependent kinases 4/6 (CDK4/6) and inhibitor of Cyclin D1, respectively. We hypothesized that treatment of SCNT reconstructed oocytes during the first cleavage with these two small molecules may prolong the first cleavage in SCNT embryos, which can have a favorable impact on reprogramming by prolonging the exposure of the fibroblast cell to reprogramming factors in the oocyte. We found that the optimal concentration and time of treatment with either Palbociclib (100 nM for 12 h) and Fenretinide (16 µM for 6 h) prolonged the time of first cleavage in treated SCNT embryos, increased the cleavage rate after 72h and improved developmental competence of SCNT derived embryos similar to IVF embryos in vitro. Hence, a transcriptional drug repositioning approach was in this work for the first time applied successfully for improving bovine SCNT efficiency.

scholarly journals 76CLONED HORSE PREGNANCIES PRODUCED USING ADULT CUMULUS CELLS

2004 ◽  
Vol 16 (2) ◽  
pp. 160 ◽  
Author(s):  
D.K. Vanderwall ◽  
G.L. Woods ◽  
K.I. Aston ◽  
T.D. Bunch ◽  
G.-P. Li ◽  
...  
Keyword(s):  
Cell Line ◽  
Nuclear Transfer ◽  
Pregnancy Loss ◽  
Transvaginal Ultrasound ◽  
Fibroblast Cell ◽  
Cumulus Cells ◽  
Fibroblast Cell Line ◽  
Embryonic Loss ◽  
Follicle Aspiration ◽  
Transfer Procedures

We recently reported the birth of the first clone of an equine species, a mule, which was produced using a fetal fibroblast cell line (Woods GL et al., 2003 Science 301, 1063). Since the birth of the first foal, two more identical cloned mule foals have been born. All three foals were delivered spontaneously without assistance, and have been healthy and vigorous since birth. Even more recently, the birth of a horse foal cloned from an adult fibroblast cell line was reported (Touchette N, 2003 Nature 424, 635). Despite these successes, the efficiency of equine nuclear transfer (NT) continues to be very low. The objective of this study was to use NT to clone adult horses using cumulus cells. Cumulus-oocyte complexes used for NT were obtained using transvaginal ultrasound-guided follicle aspiration (TVA) 24hrs after hCG treatment; oocytes were used as cytoplasts, while cumulus cells (from one of three different mares) were used as donor cells. Cumulus cells were recovered from TVA fluid, washed two times by suspension in PB1 medium (Whittingham DG, 1974 J. Reprod. Fertil. 37, 159–162), followed by centrifugation (200g) and placement in Glasgow MEM BHK-21 containing 10% FBS. Nuclear transfer procedures were performed as described (Woods GL et al., 2003 Science 301, 1063). Immediately following NT and activation procedures, cloned embryos were surgically transferred to the oviduct of recipient mares (n=2 to 5 embryos/recipient) that had ovulated within 24hrs prior to the transfer. An initial pregnancy examination was performed between Days 14 and 16 (Day 0=surgery); subsequent examinations were then performed at approximately weekly intervals. A total of 136 follicles were aspirated in 96 mares, from which 72 oocytes were recovered (53%). Sixty-two cloned embryos were subsequently transferred to recipient mares, which resulted in 7 (11.3%) ultrasonographically-detectable pregnancies. Cumulus cells from Mare 160 tended (P=0.08) to result in more pregnancies than cumulus cells from Mare 221 (4/17 v. 1/25, respectively). All seven cloned pregnancies underwent spontaneous pregnancy loss between Days 16 and 80. An embryo-proper and heartbeat were detected in three conceptuses. Of four conceptuses in which an embryo-proper was not observed, three did not develop past Day 24; therefore, they were lost before the time at which an embryo-proper generally becomes readily apparent. One conceptus developed to Day 28, yet still failed to form an embryo-proper. There were no premonitory signs of impending embryonic loss in the conceptuses that did not develop an embryo-proper; the conceptus was simply not evident at the subsequent examination. Signs of impending embryonic loss were observed in the three conceptuses in which an embryo-proper was observed, and included: (1) loss of embryonic heartbeat, (2) disorganization of the conceptus membranes, and (3) increased echogenicity of conceptus fluids. One or more of these signs were observed in all three conceptuses prior to pregnancy loss. To our knowledge, this is the first report documenting the establishment of cloned horse pregnancies produced using adult cumulus cells.

306 GENERATION OF HUMAN A20 GENE-TRANSGENIC PORCINE FETAL FIBROBLASTS FOR SOMATIC CELL NUCLEAR TRANSFER

2008 ◽  
Vol 20 (1) ◽  
pp. 233 ◽  
Author(s):  
M. Oropeza ◽  
B. Petersen ◽  
N. Hornen ◽  
D. Herrmann ◽  
H. Niemann
Keyword(s):  
Endothelial Cells ◽  
Somatic Cell ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Cell Activation ◽  
Expression Vector ◽  
Cell Clone ◽  
Cell Clones ◽  
Fetal Fibroblasts ◽  
A20 Gene

The aim of this project was to produce transgenic pigs with improved features in xenotransplantation, by expressing the human A20 gene to modulate the acute vascular rejection (AVR) reaction ocurring after porcine-to-human xenotransplantation. The A20 gene was originally characterized as a tumor necrosis factor-inducible gene in human umbilical vein endothelial cells (Opipari AW et al. 1990 J. Biol. Chem. 25, 14 705–14 708). The gene is both anti-apoptotic and anti-inflammatory in endothelial cells (Ferran C 2006 Transplantation 82(1 Suppl.), S36–S40) and could thus prevent endothelial cell activation leading to AVR. The hA20-expression vector driven by the CAGGS hybrid promoter (chicken β-actin–rabbit β-globin) containing an IRES-neomycin resistance cassette (9.1 kb) was transfected into porcine fetal fibroblasts (PFF) derived from German Landrace porcine fetal explant cultures. Transfection of 3 � 106 cells was accomplished at 450 V and 350 µF with 10 µg of plasmid DNA. Then, G418-resistant cell clones (800 µg mL–1) were screened by PCR with hA20-specific primers for hA20 integration. Eighty clones were A20-positive in PCR screening from 4 rounds of transfection. One cell clone was verified by DNA sequencing and subsequently used as donor cells in somatic cell nuclear transfer. One hundred sixty-nine embryos were transferred to 2 synchronized peripuberal German Landrace gilts, respectively. Ultrasound examination of recipient sows on Day 22 after embryo transfer confirmed established pregnancies in both recipients. One pregnancy was allowed to go to term and 7 healthy piglets were born, whereas the second pregnancy was terminated on Day 70 of pregnancy for detailed expression analysis of the 8 isolated fetuses. Results showed that the A20 vector can be integrated in PFF, and A20-transgenic PFF can be successfully used in somatic cell nuclear transfer to establish pregnancies. Further analysis will focus on the expression levels and patterns in A20-positive cell clones and the biological function in transgenic piglets. Functional assays will be conducted in vitro and in vivo. We thank Prof. Beyaert of Ghent University, Belgium for providing us with the expression vector pCAGGSEhA20.

Sign in / Sign up

Export Citation Format

Share Document