36 TREATMENT OF PORCINE FETAL FIBROBLASTS WITH DNA METHYLATION INHIBITORS OR HISTONE DEACETYLATION INHIBITORS IMPROVES DEVELOPMENT OF NUCLEAR TRANSFER EMBRYOS

2009 ◽  
Vol 21 (1) ◽  
pp. 118 ◽  
Author(s):  
D. I. Jin ◽  
N. Kenji ◽  
R. X. Han ◽  
S. M. Choi ◽  
M. Y. Kim ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Nuclear Transfer ◽  
Histone Deacetylation ◽  
Control Group ◽  
Fibroblast Cells ◽  
Fetal Fibroblast ◽  
Reconstructed Embryos ◽  
Donor Cells ◽  
Dna Methylation Inhibitors ◽  
Porcine Fetal Fibroblast

Epigenetic status of the genome of a donor nucleus has an important effect on the developmental potential of cloned embryos produced by somatic cell nuclear transfer (SCNT). DNA methylation inhibitors [such as 5-aza-2′-deoxyctidine (5-aza-dC), zebularine, and RG108] and histone deacetylase inhibitors [such as trichostatin A (TSA), sodium butyrate (NaBu), and scriptaid (SCR)] have been widely used for the alteration of the levels of the epigenetic modification of somatic cells. This study was designed to investigate the DNA methylation status of porcine fetal fibroblast cells treated with TSA or 5-aza-dC and to determine whether treatments with DNA methylation inhibitors or histone deacetylation inhibitors could improve the in vitro development of porcine reconstructed embryos. When the levels of DNA methylation in the PRE-1 sequence (repeat sequence in a euchromatic region) were examined by bisulfite sequencing following treatment of porcine fetal fibroblast cells with TSA or 5-aza-dC for 1 h, DNA methylation was decreased in 5-nm or 50-nm concentrations even if they were not significantly different. To evaluate the effect of DNA methylation inhibitors and histone deacetylation inhibitors on development of porcine nuclear transfer embryos, porcine fetal fibroblast cells were treated with 5 nm of 5-aza-dC, zebularine, or RG108 for 1 h, or with 50 nm of TSA, NaBu, or SCR for 1 h, or treated with both 50 nm TSA and 5 nm 5-aza-dC for 1 h before NT. The reconstructed embryos were electrically fused and cultured in PZM-3 for 6 days. Developmental rates of the reconstructed embryos from donor cells treated with 5-aza-dC, zebularine, or RG-108 to blastocysts significantly increased compared to the control group (21.4, 23.3, and 22.1 v. 12.3%). Blastocyst rates of the reconstructed embryos from donor cells treated with TSA, SCR, and NaBu also were significantly improved compared to the control group (30.0, 23.9, and 22.4 v. 14.5%), and TSA treatment was the highest in blastocyst rates among the treated groups. However, the development rate to the blastocyst stage was not affected when the combination of TSA and 5-aza-dC was treated. In conclusion, treatment of donor cells with DNA methylation inhibitors or histone deacetylase inhibitors improved the subsequent blastocyst development of porcine reconstructed embryos even though combined treatment with both inhibitors had no beneficial effect.

Zebularine significantly improves the preimplantation development of ovine somatic cell nuclear transfer embryos

2019 ◽  
Vol 31 (2) ◽  
pp. 357 ◽  
Author(s):  
Hui Cao ◽  
Jun Li ◽  
Wenlong Su ◽  
Junjie Li ◽  
Zhigang Wang ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Somatic Cell ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Cumulus Cells ◽  
Control Group ◽  
Developmental Potential ◽  
Reconstructed Embryos ◽  
Donor Cells ◽  
Pluripotency Genes

Aberrant DNA methylation reduces the developmental competence of mammalian somatic cell nuclear transfer (SCNT) embryos. Thus, hypomethylation-associated drugs are beneficial for improving reprogramming efficiency. Therefore, in the present study we investigated the effect of zebularine, a relatively novel DNA methyltransferase inhibitor, on the developmental potential of ovine SCNT embryos. First, reduced overall DNA methylation patterns and gene-specific DNA methylation levels at the promoter regions of pluripotency genes (octamer-binding transcription factor 4 (Oct4), SRY (sex determining region Y)-box 2 (Sox2) and Nanog) were found in zebularine-treated cumulus cells. In addition, the DNA methylation levels in SCNT embryos derived from zebularine-treated cumulus cells were significantly reduced at the 2-, 4-, 8-cell, and blastocyst stages compared with their corresponding controls (P<0.05). The blastocyst rate was significantly improved in SCNT embryos reconstructed by the cumulus donor cells treated with 5nM zebularine for 12h compared with the control group (25.4±1.6 vs 11.8±1.7%, P<0.05). Moreover, the abundance of Oct4 and Sox2 mRNA was significantly increased during the preimplantation stages after zebularine treatment (P<0.05). In conclusion, the results indicate that, in an ovine model, zebularine decreases overall DNA methylation levels in donor cumulus cells and reconstructed embryos, downregulates the DNA methylation profile in the promoter region of pluripotency genes in donor cells and ultimately elevates the expression of pluripotency genes in the reconstructed embryos, which can lead to improved development of SCNT embryos.

20 PRODUCTION OF NUCLEAR TRANSFER EMBRYOS FROM PORCINE FETAL FIBROBLAST CELLS CARRYING A TETRACYCLINE-INDUCIBLE TRANSGENE

2006 ◽  
Vol 18 (2) ◽  
pp. 118
Author(s):  
K. S. Ahn ◽  
M. Kwon ◽  
B. C. Koo ◽  
J. Y. Won ◽  
S. Y. Heo ◽  
...  
Keyword(s):  
Nuclear Transfer ◽  
Transgenic Animals ◽  
Transformed Cells ◽  
Fibroblast Cells ◽  
Transgenic Pigs ◽  
Blastocyst Development ◽  
Fetal Fibroblast ◽  
Gfp Gene ◽  
Retrovirus Vector ◽  
Porcine Fetal Fibroblast

Constitutive expression of A transgene often results in serious physiological disturbances in transgenic animals. For instance, systemic overexpression of human growth hormone in transgenic pigs has resulted in detrimental side effects in general health and reproductive performance. One of the solutions to such problem would be inducible expression of a transgene that may restrict production of foreign proteins from transgenic animals only when needed. In this study, a retrovirus vector was designed to express the green fluorescent protein (GFP) gene under the control of the tetracycline-inducible promoter. Transformation of porcine fetal fibroblast cells was achieved by infection of the cells with the vector and subsequent antibiotic selection. To induce transgene expression, transformed porcine fetal fibroblast cells were cultured in medium supplemented with doxycycline for 48 h. Induction of the GFP gene was verified by the emission of fluorescence from transformed cells. Nuclei of transformed cells with or without doxycycline treatment were transferred into enucleated oocytes, and the induction efficiency was analyzed by monitoring fluorescent emission during development of reconstituted embryos to the blastocyst stage. In addition, differences in the rates of blastocyst development between experimental groups were analyzed by Student's t-test. Blastocyst formation of nuclear transfer embryos using transformed cells with tetracycline-inducible retrovirus vector (12.0%, 128/1072) was not significantly different (P > 0.05) from that with non-inducible control vectors (13.7%, 41/300), suggesting that an introduction of tetracycline-inducible retrovirus vector was not particularly harmful to the development of nuclear transfer embryos. Also, the blastocyst development rate of nuclear transfer embryos after induction of transgene by doxycycline (12.1%, 99/815) was not significantly different (P > 0.05) from that of the non-induced counterparts (11.3%, 29/257), suggesting that the induction of transgene did not affect the development of transgenic clone embryos. In a majority of embryos, high expression of the GFP gene was observed in cloned embryos with transgene induction, whereas poor or no GFP expression was detected in non-induced controls. The results from this study suggest that tetracycline-inducible expression of transgenes in nuclear transfer embryos may be used for production of foreign proteins in transgenic animals in a more controlled manner than with conventional procedures. Further experiments on transfer of cloned embryos carrying such an inducible transgene to recipients may enable production of transgenic pigs with fewer side effects from unregulated expression of the transgene.

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

2012 ◽  
Vol 24 (1) ◽  
pp. 141
Author(s):  
Z. W. Wang ◽  
P. Zhang ◽  
S. Zhang ◽  
X. Ma ◽  
Y. P. Yin ◽  
...  
Keyword(s):  
Histone Deacetylase ◽  
Nuclear Transfer ◽  
Expression Vector ◽  
Mrna Level ◽  
Negative Control ◽  
Control Group ◽  
Fibroblast Cells ◽  
Control Vector ◽  
Histone Deacetylase 1 ◽  
Donor Cells

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

70 FETAL FIBROBLAST CELLS PERMEABILIZED WITH STREPTOLYSIN O IMPROVE THE RATES OF FUSION AND IN VITRO DEVELOPMENT OF PORCINE RECONSTRUCTED EMBRYOS

2007 ◽  
Vol 19 (1) ◽  
pp. 152
Author(s):  
K. Naruse ◽  
Y. M. Shin ◽  
Y. S. Quan ◽  
C. S. Park ◽  
D. I. Jin
Keyword(s):  
Cell Number ◽  
Fibroblast Cells ◽  
Fetal Fibroblast ◽  
In Vitro Development ◽  
Reconstructed Embryos ◽  
Streptolysin O ◽  
Donor Cells ◽  
Developmental Rates ◽  
Vitro Development

Streptolysin O (SLO) is known to bacterial proteins that form very large pores in the plasma membrane of mammalian cells. SLO has been used in the delivery of proteins into living cells following permeabilization. The objective of this study was to investigate the effect of permeabilization of donor cells using SLO on in vitro development of porcine reconstructed embryos. Porcine fetal fibroblast cells were treated with Ca2+-free DMEM medium containing 200 ng mL−1 of SLO for 50 min before or after trypsinization. Those SLO-treated donor cells were injected into enucleated oocytes, fused with 2 DC pulses (1.2 kV cm−1, 30 µs) and cultured in procine zygote medium-3 (PZM-3) for 6 days. In vitro development of the reconstructed embryos was examined. SLO treatment after trypsinzation significantly increased (P &lt; 0.05) the percentage of fusion rates and blastocyst developmental rates compared with that before trypsinization or in the nontreated group. Additionally there were no significant differences in fusion rates, cleavage rates, blastocyst developmental rates, and total cell number of blastocysts between the SLO-treated group before trypsinzation and the nontreated group. Next, after the trypsinzation treatment, fetal fibroblast cells were incubated in Ca2+-free DMEM containing 200 ng mL−1 of SLO for 0, 30, 50, and 70 min and SLO-treated donor cells were also tested for fusion rate and developmental capability following reconstruction. The 50-min group of SLO-treated cells significantly increased (P &lt; 0.05) the percentage of fusion rates (90.6 vs. 77.6, 85.4, and 78.5%) and blastocyst developmental rates (24.7 vs. 13.5, 11.2, and 13.5%) compared with the other groups (Table 1). However, there was no significant difference in the total cell number of blastocysts among SLO-treated groups. Although cleavage rates the in SLO-treated groups were not significantly different from those of the nontreated group, there the cleavage rates were slightly in SLO-treated groups. In conclusion, permeabilization of porcine fetal fibroblast cells with SLO improves the fusion rates and in vitro development of porcine reconstructed embryos. Table 1.Effects of SLO treatment of fetal fibroblasts by different exposure times on in vitro development of porcine reconstructed embryos

scholarly journals 65 PRODUCTION OF PORCINE NUCLEAR TRANSFER EMBRYOS USING FETAL FIBROBLAST CELLS ANALYZED ON APOPTOSIS

2005 ◽  
Vol 17 (2) ◽  
pp. 182 ◽  
Author(s):  
M. Skrzyszowska ◽  
M. Samiec
Keyword(s):  
Nuclear Transfer ◽  
Fibroblast Cell ◽  
State Committee ◽  
Fibroblast Cells ◽  
Developmental Potential ◽  
Fetal Fibroblast ◽  
Functional Quality ◽  
Donor Cells ◽  
Morphological Transformations

One of the most important factors that determine the developmental potential of mammalian cloned embryos is the structuro-functional quality of nuclear donor cells. Biochemical changes that are some of the earliest symptoms of apoptosis signal transduction are not reflected in the morphological features of somatic cells. Therefore, an appropriate system of cell selection would enable the sorting of donor nuclei with high morphological and biochemical susceptibility to somatic cloning. The aim of our study was to examine the in vitro developmental competencies of porcine nuclear transfer (NT) embryos reconstructed with fetal fibroblast cells that had been analyzed for apoptosis by live-fluorescent labelling. Frozen/thawed fetal fibroblast cells, which had been in vitro-cultured to a confluent state, were used for analysis. To detect the early apoptotic changes in the fibroblast cells, a single cell suspension of nuclear donor cells was subjected to dyeing with live-DNA green fluorochrome YO-PRO-1. The recipient cells were in vitro-matured oocytes. Maternal chromosomes were removed by a chemically assisted microsurgical technique. Then, single nuclear donor cells were inserted into the perivitelline space of enucleated oocytes. Fibroblast cell-ooplast couplets were simultaneously fused and activated with two consecutive DC pulses of 1.2 kV/cm for 60 μs. Reconstructed embryos were in vitro cultured in 50-μL drops of NCSU-23 medium supplemented with 0.4% BSA-V for 6 to 7 days at 38.5°C in a humidified atmosphere of 5% CO2 and 95% air. The rates of cleavage and development to morula/blastocyst stages were examined on Days 2 and 6/7, respectively. After fluorescent analysis of approximately 50 different random samples collected from the population of fetal fibroblast cells, that had been labelled with YO-PRO-1 dye, it was found that a relatively high proportion of donor cells revealed ultrastructural apoptotic changes. The percentage of late apoptotic cells with advanced morphological transformations was about 40% of the total pool of the fibroblast cells. A total of 262/270 (97.0%) enucleated oocytes were subjected to reconstruction and 141/262 (53.8%) were successfully fused with non-apoptotic nuclear donor cells. Following the simultaneous fusion/activation protocol, reconstituted oocytes were selected for in vitro culture. Out of 262, 133 (50.8%) cultured NT embryos cleaved. The frequencies of cloned embryos that reached the morula and blastocyst stages were 48/133 (36.0%) and 10/133 (7.5%), respectively. In conclusion, morphology is a sufficient selection factor for detection of apoptosis in the cultured (confluent) fetal fibroblast cells to be used for cloning. Moreover, it was found that YO-PRO-1 fluorochrome may be not able to detect the early phases of apoptosis, because only the morphologically abnormal cells emitted the YO-PRO-1-derived fluorescence. This research was supported by the State Committee for Scientific Research as a Solicited Project number PBZ-KBN-084/P06/2002/4.2 from years 2003 to 2005.

39 DEVELOPMENTAL COMPETENCE OF RECONSTRUCTED EMBRYOS PRODUCED BY NUCLEAR TRANSFER BETWEEN CYNOMOLGUS MONKEY FIBROBLAST CELLS AND RABBIT OOCYTES

2006 ◽  
Vol 18 (2) ◽  
pp. 128 ◽  
Author(s):  
Y. Hosoi ◽  
T. Yamochi ◽  
N. Kawata ◽  
M. Takenoshita ◽  
S. Ohta ◽  
...  
Keyword(s):  
Cynomolgus Monkey ◽  
Nuclear Transfer ◽  
Culture Media ◽  
Genetic Material ◽  
Blastocyst Stage ◽  
Developmental Competence ◽  
Fibroblast Cells ◽  
Cell Stage ◽  
Reconstructed Embryos ◽  
Donor Cells

Interspecies nuclear transfer has been used as an invaluable tool for studying nucleus-cytoplasm interactions and it may also be used for rescuing endangered species whose oocytes are difficult to obtain. In this study, we investigated interaction of the cynomolgus monkey cell as a nuclear donor with the rabbit oocyte as a host cytoplasm. Whole cynomolgus fibroblast cells were injected into the rabbit enucleated oocytes (cynomolgus-rabbit cloned embryos) and cultured in TCM-199 and RPMI 1640 culture media. Rabbit-rabbit cloned embryos we used as control in this study. Karyotype analyses confirmed that genetic material of blastocysts was derived from the cynomolgus donor cells at blastocyst stage. Mitochondrial constitution analysis of the cynomolgus-rabbit cloned embryos indicated that mitochondria from both donor cells and enucleated oocytes coexisted. After culture for 168 h post-nuclear transfer, all cynomolgus-rabbit cloned embryos in TCM-199 were arrested at the 8-cell stage, but some of them developed to the blastocyst stage in RPMI 1640 (11/59, 18.6%). In this experiment, the nutrition requirement in vitro and the cleavage rate at each 24 h were examined. When TCM-199 was supplemented with lactate, some of these embryos developed to the blastocyst stage (15.3%, 2/13). This means that cynomolgus-rabbit cloned embryos might be controlled by the donor nucleus even in these early developmental stages. However, the timing of cleavage of cynomolgus-rabbit cloned embryos is very similar to that of the rabbit-rabbit cloned embryos. Time of cleavage may depend on the protein accumulated in the cytoplasm. In the prolonged culture of reconstructed embryos on feeder cells, adhesion cells were observed. These cells are also very similar to the cells derived from cynomolgus embryos by the same method. Our results suggest that: (1) a cynomolgus nucleus can co-ordinate with rabbit oocyte cytoplasm in early embryo development, (2) the 8- to 16-cell stage block in the cynomolgus-rabbit cloned embryos may due to the same reason as that in the cynomolgus embryos, and (3) ooplasmic factors that control time of cleavage are highly conservative between the species.

80 EFFECT OF MEDIA, SYNCHRONIZATION OF FIBROBLAST CELLS, CULTURE TIME, OXYGEN CONCENTRATION, AND ACTIVATION ON NUCLEAR-TRANSFERRED PORCINE OOCYTES

2007 ◽  
Vol 19 (1) ◽  
pp. 157
Author(s):  
J. H. Quan ◽  
H. B. Seok ◽  
S. K. Kim
Keyword(s):  
Nuclear Transfer ◽  
Culture Medium ◽  
Atmospheric Condition ◽  
Blastocyst Stage ◽  
Fibroblast Cells ◽  
Fetal Fibroblast ◽  
Donor Cells ◽  
The Impact ◽  
Cells Cultured

The purpose of this study was to investigate the impact of culture medium, culture duration, and atmospheric condition on the fusion and in vitro development rates of nuclear transfer porcine embryos constructed by the microinjection of fetal fibroblast cells into in vitro-matured oocytes. Single fetal donor cells were deposited into the perivitelline space of enucleated oocytes, followed by electrical fusion and activation. Activated embryos were cultured in NCSU-23 medium supplemented with 5% FBS, at 38.5�C for 6 to 8 days in 5% CO2 and air. In Experiment 1, the fusion rates of nuclear transfer embryos did not differ from those of fetal fibroblast cells incubated in 5% FBS + NCSU-23 or 5% FBS + TL-HEPES medium, nor did fusion rates of donor cells differ among 1–8-h incubation durations. Fusion rates for the 4 treatment subclasses ranged from 72.1% to 78.0%. In Experiment 2, pre-synchronization in medium containing 0.1 �g mL-1 Hoechst(H) 33342 increased during the period from 0 and 8 h of culture up to 15 h, the end of the synchronization period, at which time there was a significantly increased percentage of porcine fibroblast cells at the G2/M stage (12.4%, 17.5%, and 47.6%; P &lt; 0.01). Neither an increase in the concentration of H 33342 (0.2–1.6 �g mL-1) nor a longer exposure time (12 h, 18 h, and 24 h) increased the proportion of porcine G2/M fibroblasts. In Experiment 3, fusion rates did not differ significantly between nuclear transfer embryos constructed using donor cells cultured in 5% FBS + NCSU-23 medium for 1–2, 6–8, or 12–14 days (60.0%, 73.3%, and 62.5%, respectively). The cleavage rate for nuclear transplant embryos using fetal fibroblast cells cultured for 1–2 days was 44.0%, which was significantly less than the 56.7% and 50.0% for 6–8 or 12–14 days of culture, respectively (P &lt; 0.05). In Experiment 4, the proportions of nuclear transfer embryos that developed to the e2 cell and to the blastocyst stage were not affected significantly by culture medium (5% FBS + NCSU-23 or 5% FBS + TL-HEPES) or by O2 concentration during culture (5% vs. 10%). The developmental rates to the e2 cell stage ranged from 65.9% to 70.1%, and those to the blastocyst stage ranged from 9.8% to 12.5%, for the 4 treatment subclasses. Blastocyst rate was highest for embryos cultured in 5% FBS + NCSU-23 under a gas atmosphere of 5% O2 in air.

Production of transgenic goats expressing human coagulation factor IX in the mammary glands after nuclear transfer using transfected fetal fibroblast cells

2012 ◽  
Vol 22 (1) ◽  
pp. 131-142 ◽  
Author(s):  
Amir Amiri Yekta ◽  
Azam Dalman ◽  
Poopak Eftekhari-Yazdi ◽  
Mohammad Hossein Sanati ◽  
Abdol Hossein Shahverdi ◽  
...  
Keyword(s):  
Nuclear Transfer ◽  
Coagulation Factor ◽  
Mammary Glands ◽  
Factor Ix ◽  
Fibroblast Cells ◽  
Fetal Fibroblast ◽  
Coagulation Factor Ix ◽  
Transgenic Goats

27 SODIUM CHLORIDE TREATMENT OF CELL MEMBRANE-PERMEABILIZED NUCLEAR DONOR CELLS FACILITATES THE DISPLACEMENT OF THE SOMATIC HISTONE H1 AND HMG-17 PROTEINS IN RECONSTRUCTED PORCINE EMBRYOS

2006 ◽  
Vol 18 (2) ◽  
pp. 122
Author(s):  
L. Che ◽  
V. Bordignon
Keyword(s):  
Sodium Chloride ◽  
Cell Membrane ◽  
Chromatin Structure ◽  
Nuclear Transfer ◽  
Chromatin Binding ◽  
Salt Extraction ◽  
Reconstructed Embryos ◽  
High Order Chromatin Structure ◽  
Donor Cells ◽  
High Order Chromatin

Developmental efficiency of somatic cell-reconstructed embryos depends on extensive remodeling of chromatin structural components. Due to their importance for maintaining the high-order chromatin structure and controlling DNA functions, including replication, transcription, repair, and recombination, histones and other chromatin-binding proteins represent leading choice markers to investigate nuclear remodeling in reconstructed embryos. The main objective of this study was to investigate whether or not the exposure of cell membrane permeabilized nuclear donor cells to sodium chloride (salt-extraction) would facilitate the displacement of chromatin-binding proteins in reconstructed porcine embryos. Both linker histone H1 (H1) and high-mobility group (HMG) proteins are known to affect gene expression through the modulation of the high-order chromatin structure. Standard methods of oocyte enucleation and electrofusion were applied for embryo reconstruction using in vitro-matured oocytes and control or salt-extracted fetal fibroblast cells. For salt-extraction, confluent cell cultures were washed with Ca2+/Mg2+-free Hank's balanced salt solution (HBSS); cells were permeabilized by incubation with 1 µg/mL of streptolysin O at 37°C for 30 min in HBSS, and then maintained in Tris-NaCl buffer (10 mM Tris-HCl, 0.5 mM MgCl2, 0.7 M NaCl, 1 M sucrose) for 5 min. After salt-extraction, cells were rinsed and cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 2 mM CaCl2 for 1 h at 37.5°C for membrane resealing prior to nuclear transfer. Reconstructed embryos were activated using ionomycin (15 µM/5 min) and strontium chloride (Sr2+; 10 mM/4 h), and then cultured in PZM-3 medium. Immunostaining for H1 and HMG-17 was performed in nuclear donor cells and embryos at different stages after reconstruction. The time required for H1 displacement in transplanted nuclei was reduced by the salt-extraction treatment (Table 1). Salt-extracted cells showed a stronger HMG-17 cytoplasmic signal compared to control cells. The proportion of HMG-17-positive reconstructed embryos at 1, 3, and 6 h was 54 vs. 19, 57 vs. 44, and 75 vs. 62, for control and salt-extracted cells, respectively. These data suggest that salt-extraction prior to nuclear transplantation enhances the remodeling of chromatin structure in embryos reconstructed with somatic cell nuclei. Table 1. Proportion (n) of H1-positive stained embryos after different times from parthenogenetic activation (PA) and nuclear transfer using control (NT-control) or salt-extracted (NT-extracted) cells This work was supported by a NSERC Discovery Grant to VB.

59 SYNCHRONIZATION OF CELL CYCLE STAGE OF BUFFALO (BUBALUS BUBALIS) FETAL FIBROBLAST CELLS BY DIFFERENT TREATMENTS

2011 ◽  
Vol 23 (1) ◽  
pp. 135
Author(s):  
N. L. Selokar ◽  
A. George ◽  
A. P. Saha ◽  
R. Sharma ◽  
M. Muzaffar ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Bubalus Bubalis ◽  
Serum Starvation ◽  
Fibroblast Cells ◽  
Cloning Efficiency ◽  
Fetal Fibroblast ◽  
Cell Cycle Stage ◽  
Cell Cycle Synchronization ◽  
Donor Cells ◽  
Major Factors

Cell cycle stage of donor cells significantly influences the cloning efficiency during SCNT. Donor cells in G1/G0 stage have better capability to undergo nuclear reprogramming following transfer to an unfertilized oocyte. The lack of availability of cells synchronized at G1/G0 stage is one of the major factors limiting cloning efficiency in buffalo. The aim of this study was to compare the efficacy of various methods for cell cycle synchronization of buffalo fetal fibroblast cells for SCNT. Cells isolated from fetus, 2 to 3 months old, were cultured in DMEM + 10% FBS. The primary culture was sub-cultured 8 to 10 times. For cell cycle synchronization, the cells were cultured to 1) 60 to 70% confluence (controls), 2) 60 to 70% confluence followed by serum starvation (DMEM + 0.5% FBS) for 24 h (serum starved), 3), full confluence followed by culture for additional 3 to 5 days (full confluent), 4) full confluence followed by serum starvation (DMEM + 0.5% FBS) for 24 h (full confluent+serum starved) and 5) 60 to 70% confluence followed by treatment with roscovitine (10, 20, or 30 μM) for 24 h. The synchronization efficiency was examined by propidium iodide staining followed by analysis of DNA content using flow cytometry and the data were analysed by 1-way ANOVA followed by Fisher’s l.s.d. test after arcsine transformation. The percentage of cells in G0/G1 phase of cell cycle was significantly higher (P < 0.05) in the full confluent+serum starved and roscovitine treated (20 or 30 μM) groups than that in the full confluent group and that treated with 10 μM roscovitine which, in turn, was higher (P < 0.05) than that in the serum starved and control groups. These results suggest that buffalo fetal fibroblast cells can be synchronized by roscovitine treatment or by serum starvation of fully confluent cell cultures to obtain a high proportion of cells in G0/G1 stage for SCNT. Table 1.Buffalo skin fibroblast cells at various stages following different treatments for cell cycle synchronization Supported by grant No. 1(5)/2007-NAIP from ICAR, India.

Sign in / Sign up

Export Citation Format

Share Document