309 PRODUCTION OF CATTLE BY NUCLEAR TRANSFER FROM CELLS IN WHICH A GENE IS DISRUPTED

2009 ◽  
Vol 21 (1) ◽  
pp. 251
Author(s):  
M. Urakawa ◽  
Y. Sendai ◽  
A. Ideta ◽  
K. Hayama ◽  
Y. Shinkai ◽  
...  
Keyword(s):  
Pregnancy Rate ◽  
Gene Targeting ◽  
Prion Protein ◽  
Nuclear Transfer ◽  
Antibiotic Resistance Gene ◽  
Control Group ◽  
Gestation Length ◽  
Entry Site ◽  
Donor Cells ◽  
Fetal Fibroblasts

Gene-targeted animals provide a powerful model to examine gene functionality. In this study, we examined the effect of gene targeting of donor cells for nuclear transfer (NT) on the pregnancy rate and on viability of the offspring after embryo transfer. Gene-targeted (tg; targeting of both alleles of the gene encoding bovine prion protein) or non-manipulated (control) bovine fetal fibroblasts were used for NT. A promoterless positive selection vector (pPrP5.2) containing an internal ribosome entry site-antibiotic resistance gene (neo) cassette and loxP sequences was used to disrupt the bovine prion protein gene. The cells (tg) in which homologous recombination was occurred were used for NT. The tg and control cells were cultured in DMEM with 10% FCS and were prepared in the early G1 phase to our previous report (Urakawa M et al. 2004 Theriogenology 62, 714–728). Each donor cell was inserted into an enucleated in vitro-matured (19 h) oocyte. Cell fusion (DC, 200 V mm–1, 10 μs) and activation (DC, 100 V mm–1 , 60 μs) were done in 0.3 m mannitol solution. The NT embryos were then activated with 5 μm Ca-ionophore and 10 μg of mL–1 cycloheximide and were cultured with bovine oviduct epithelial cells in CR1aa with 5% CS. The blastocyst rates were judged at 6 days after NT. The blastocysts were non-surgically transferred to recipient heifers. The recipients were monitored daily for heat behavior, examined by ultrasound at Day 30 and 60, and then observed monthly to confirm pregnancy. The offspring born in the tg group were confirmed by PCR to be transgenic. Statically significance was tested using a chi-square test or t-test. Developmental rate to the blastocyst stage, pregnancy rate at Day 30 and 60, and calving rate did not differ significantly between tg and the control group (Table 1). Gestation length (tg; 290.0 ± 2.2 days v. control; 290.5 ± 3.9 days) and birth weight (tg; 39.6 ± 8.0 kg v. control; 40.2 ± 4.1 kg) were not significantly different. These results indicate that gene targeting of donor cells used for NT does not significantly affect the development of embryos, pregnancy rate, or the viability of the offspring. Table 1.Development of NT embryos with tg or control cells

29 TREATMENT OF DONOR CELLS WITH XENOPUS OOCYTE EXTRACT ENHANCED SOMATIC CELL NUCLEAR TRANSFER EMBRYO DEVELOPMENT

2012 ◽  
Vol 24 (1) ◽  
pp. 126
Author(s):  
X. Yang ◽  
J. Mao ◽  
E. M. Walters ◽  
M. T. Zhao ◽  
K. Lee ◽  
...  
Keyword(s):  
Somatic Cell ◽  
Embryo Development ◽  
Natural Science ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Control Group ◽  
Blastocyst Formation ◽  
Donor Cells ◽  
Fetal Fibroblasts ◽  
Frog Oocyte

Somatic cell nuclear transfer (SCNT) efficiency in pigs and other species is still very low. This low efficiency and the occurrence of developmental abnormalities in offspring has been attributed to incomplete or incorrect reprogramming. Cytoplasmic extracts from both mammalian and amphibian oocytes can alter the epigenetic state of mammalian somatic nuclei as well as gene expression to more resemble that of pluripotent cells. Rathbone et al. (2010) has showed that pretreating somatic donor cells with frog oocyte extract (FOE) increased live birth in ovine. Liu et al. (2011) also reported that treating donor cells with FOE enhanced handmade clone embryo development in pigs. The aim of this study was to evaluate the early development of cloned embryos produced with porcine GFP fibroblasts pre-treated with a permeabilizing agent, digitonin and matured frog oocyte extract. Frog egg cytoplasmic extract was prepared from one frog's oocytes after being matured in vitro to MII stage. The experiment included 2 groups. In the FOE-treated group, GFP-tagged fetal fibroblasts were permeabilized by digitonin (15 ng mL–1) and incubated in FOE containing an ATP-regenerating system (2.5 mM ATP, 125 μM GTP, 62.5 μg mL–1 of creatine kinase, 25 mM phosphocreatine and 1 mM NTP) at room temperature (24°C) for 2 h; cell membranes were re-sealed by culturing in 10% FBS in DMEM media for 2.5 h at 38.5°C before used as donor cells. In the control group, the same donor cells were treated with digitonin, but without frog oocyte extract incubation. The SCNT embryos were produced by using the 2 groups of donor cells as described above. In total, 305 control and 492 FOE oocytes were enucleated from 8 biological replicates. Two hundred fifty control and 370 FOE couplets were fused and cultured in porcine zygote medium 3. Percent cleavage was recorded on Day 2 and the percent blastocyst formation was determined on Day 7 (SCNT day = 0). In addition, the number of nuclei in the blastocysts was recorded on Day 7. Percent fusion, cleavage, blastocyst formation and number of nuclei in blastocysts were analysed by using SAS software (v9.2), with day and treatment class as main effects. There was no difference in percent fusion (FOE, 76.2 ± 2.5% vs control, 80.8 ± 2.8%) or in cleavage (FOE: 74.8 ± 2.5% vs control: 74.6 ± 2.9%). Only green blastocysts with 16 or more nuclei were considered to be a true SCNT blastocyst. The percent blastocyst was higher in the FOE group than that in the control (13.9 ± 0.8% vs 9.5 ± 0.9%, P < 0.05), whereas the number of nuclei in the blastocysts was not different between the 2 groups (39.7 ± 2.4, 35.9 ± 3.8 for FOE and control, respectively). In conclusion, our study demonstrated that pre-treatment of donor cells with digitonin and Xenopus MII oocyte extract increased porcine SCNT embryo development to blastocyst and cloning efficiency. Funded by the National Natural Science Foundation of China (NO. 31071311), Natural Science Foundation of Fujian Province of China (No. 2009J06017) and NIH U42 RR18877.

102 RABBIT CLONING: HISTONE ACETYLATION STATUS OF DONOR CELLS AND CLONED EMBRYOS

2007 ◽  
Vol 19 (1) ◽  
pp. 168
Author(s):  
V. Zakhartchenko ◽  
F. Yang ◽  
R. Hao ◽  
E. Wolf
Keyword(s):  
Histone Acetylation ◽  
Nuclear Transfer ◽  
Epigenetic Mark ◽  
Cloning Efficiency ◽  
Developmental Potential ◽  
Acetylation Status ◽  
Donor Cells ◽  
Fetal Fibroblasts

Epigenetic status of the genome of a donor nucleus is likely to be associated with the developmental potential of cloned embryos produced by somatic cell nuclear transfer (SCNT). Prevention of epigenetic errors by manipulation of the epigenetic status of donor cells is expected to result in improvement of cloning efficiency. In this study, we transferred cultured rabbit cumulus cells (RCC) and fetal fibroblasts (RFF) from genetically marked rabbits (Ali/Bas) into metaphase II (MII) oocytes and analyzed the levels of histone H3K9 acetylation in donor cells and cloned embryos. We also assessed the correlation between the histone acetylation status of donor cells and cloned embryos and their developmental potential. To test whether alteration of the histone acetylation status affects development of cloned embryos, we treated donor cells with sodium butyrate (NaBu), a histone deacetylase inhibitor. Further, we tried to improve cloning efficiency by chimeric complementation of cloned embryos with one or two blastomeres from in vitro-fertilized or parthenogenetic embryos. Histone acetylation in donor cells and cloned embryos was detected by anti-acH3K9 antibody using Western immunoblot analysis or immunochemistry, respectively. Data were analyzed by chi-square (developmental rates) or Student-Newman-Keuls (histone acetylation) test. The levels of acetylated histone H3K9 were higher in RCCs than in RFFs (P &lt; 0.05). Although the type of donor cells did not affect development to blastocyst, after transfer into recipients, RCC-cloned embryos induced a higher initial pregnancy rate as compared to RFF-cloned embryos (40% vs. 20%; P &lt; 0.05). However, almost all pregnancies with either type of cloned embryos were lost by the middle of gestation and only one fully developed; a live RCC-derived rabbit was obtained. Treatment of RFFs with NaBu significantly (P &lt; 0.05) increased the level of histone H3K9/14 acetylation and the proportion of nuclear transfer embryos developing to blastocyst (49% vs. 33% with non-treated RFF; P &lt; 0.05). The distribution of signals for acH3K9 in either group of cloned embryos did not resemble that in in vivo-fertilized embryos, suggesting that reprogramming of this epigenetic mark is aberrant in cloned rabbit embryos and cannot be corrected by treatment of donor cells with NaBu. Aggregation of embryos cloned from NaBu-treated RFFs with blastomeres from in vivo-derived embryos improved development to blastocyst, but no cloned offspring were obtained. Two live cloned rabbits were produced from this donor cell type only after aggregation of cloned embryos with a parthenogenetic blastomere. Our study demonstrates that the levels of histone acetylation in donor cells and cloned embryos correlate with their developmental potential and can be a useful epigenetic mark to predict efficiency of SCNT rabbits. This work was supported by the Bayerische Forschungsstiftung and by Therapeutic Human Polyclonals, Inc.

257 EXPRESSION OF DEVELOPMENTAL GENES IN PORCINE NUCLEAR TRANSFER EMBRYOS RECONSTRUCTED WITH BONE MARROW MESENCHYMAL STEM CELLS

2006 ◽  
Vol 18 (2) ◽  
pp. 236
Author(s):  
B. Mohana Kumar ◽  
H.-F. Jin ◽  
J.-G. Kim ◽  
S. Balasubramanian ◽  
S.-Y. Choe ◽  
...  
Keyword(s):  
Gene Expression ◽  
Stem Cells ◽  
Bone Marrow ◽  
Mesenchymal Stem Cells ◽  
Nuclear Transfer ◽  
Expression Profiles ◽  
Donor Cells ◽  
Fetal Fibroblasts ◽  
Marrow Mesenchymal Stem Cells

Abnormal gene expression is frequently observed in nuclear transfer (NT) embryos and is one of the suggested causes of the low success rates of this approach. Recent study has suggested that adult stem cells may be better donor cells for NT, as their less differentiated state may ease epigenetic reprogramming by the oocyte (Kato et al. 2004 Biol. Reprod. 70, 415-418). In the present study, we investigated the expression profile of some selected genes involved in the development of the pre-implantation embryos of in vivo- and NT-derived origin using bone marrow mesenchymal stem cells (MSCs) and porcine fetal fibroblasts (pFF) as donors. Isolated population of MSCs from porcine bone marrow were characterized by cell-surface antigen profile (CD13pos, CD105pos, CD45neg, and CD133neg) and by their extensive consistent differentiation to multiple mesenchymal lineages (adipocytic, osteocytic and chondrocytic) under controlled in vitro conditions (Pittenger et al. 1999 Science 284, 143-147). Primary cultures of pFF from a female fetus at <30 days of gestation were established. for NT, donor cells at 3-4 passages were employed. Embryos cloned from MSCs showed enhanced developmental potential compared to pFF cloned embryos, indicated by higher rates of blastocyst formation (15.3% � 4.8 and 9.0% � 3.9, respectively) and total cell number (31.5 � 7.2 and 20.5 � 5.4, respectively) in Day 7 blastocysts. Total RNA was extracted from pools (triplicates) of 10 embryos each of 8-cell, morula, and blastocyst stages of in vivo and NT origin using Dynabeads� mRNA DIRECT" kit (Dynal, Oslo, Norway). Reverse transcription was performed with a Superscript" III cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed on a Light cycler� using FastStart DNA Master SYBR Green I (Roche Diagnostics, Mannheim, Germany). The expression profiles of genes involved in transcription (Oct-4, Stat3), DNA methylation (Dnmt1), de novo methylation (Dnmt3a), histone deacetylation (Hdac2), anti-apoptosis (Bcl-xL), and embryonic growth (Igf2r) were determined. The mRNA of H2a was employed to normalize the levels. Significant differences (P < 0.05) in the relative abundance of Stat3, Dnmt1, Dnmt3a, Bcl2, and Igf2r were observed in pFF NT embryos compared with in vivo-produced embryos, whereas embryos derived from MSCs showed expression patterns similar to those of in vivo-produced embryos. However, Oct-4 and Hdac2 revealed similar expression profiles in NT- and in vivo-produced embryos. These results indicate that MSC-derived NT embryos had enhanced embryonic development and their gene expression pattern more closely resembled that of in vivo-produced embryos. Hence, less differentiated MSCs may have a more flexible potential in improving the efficiency of the porcine NT technique. This work was supported by Grant No. R05-2004-000-10702-0 from KOSEF, Republic of Korea.

59 HIGHER BLASTOCYST FORMATION OF SOMATIC CELL NUCLEAR TRANSFER EMBRYOS DOES NOT GUARANTEE BETTER PREGNANCY IN PIG

2007 ◽  
Vol 19 (1) ◽  
pp. 147
Author(s):  
E. Lee ◽  
K. Song ◽  
Y. Jeong ◽  
S. Hyun
Keyword(s):  
Somatic Cell ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Cell Number ◽  
Skin Fibroblasts ◽  
Miniature Pig ◽  
Donor Cells ◽  
Fetal Fibroblasts

Generally, blastocyst (BL) formation and embryo cell number are used as main parameters to evaluate the viability and quality of in vitro-produced somatic cell nuclear transfer (SCNT) embryos. We investigated whether in vitro development of SCNT pig embryos correlates with in vivo viability after transfer to surrogates. For SCNT, cumulus–oocyte complexes (COCs) were matured in TCM-199 supplemented with follicular fluid, hormones, EGF, cysteine, and insulin for the first 22 h and in a hormone-free medium for 18 h. Three sources of pig skin cells were used as nuclear donor: (1) skin fibroblasts of a cloned piglet that were produced by SCNT of fetal fibroblasts from a Landrace × Yorkshire × Duroc F1 hybrid (LYD), (2) skin fibroblasts of a miniature pig having the human decay accelerating factor gene (hDAF-MP), and (3) skin fibroblasts of a miniature pig with a different strain (MP). MII oocytes were enucleated, subjected to nuclear transfer from a donor cell, electrically fused, and activated 1 h after fusion. SCNT embryos were cultured in a modified NCSU-23 (Park Y et al. 2005 Zygote 13, 269–275) for 6 days or surgically transferred (110–150 fused embryos) into the oviduct of a surrogate that showed standing estrus on the same day as SCNT. Embryos were examined for cleavage and BL formation on Days 2 and 6, respectively (Day 0 = the day of SCNT). BLs were examined for their cell number after staining with Hoechst 33342. Pregnancy was diagnosed by ultrasound 30 and 60 days after embryo transfer. Embryo cleavage was not affected by donor cells (82, 81, and 72% for LYD, hDAF-MP, and MP, respectively), but BL formation was higher (P &lt; 0.05) in hDAF-MP (16%) than in LYD (9%) and MP (6%). MP showed higher (P &lt; 0.05) BL cell number (46 cells/BL) than hDAF-MP (34 cells) but did not show a difference from LYD (37 cells). LYD and MP showed higher pregnancy rates (Table 1) on Days 30 and 60, even though they showed lower BL formation in vitro. Due to a relatively small number of embryo transfers through a limited period, we could not exclude any possible effects by seasonal or operational differences. These results indicated that pregnancy did not correlate with in vitro BL formation of SCNT pig embryos but rather were affected by the source of donor cells. Table 1.In vivo development of somatic cell nuclear transfer pig embryos derived from different sources of donor cells This work was supported by the Research Project on the Production of Bio-organs (No. 200506020601), Ministry of Agriculture and Forestry, Republic of Korea.

357 EARLY FETAL DEVELOPMENT OF NUCLEAR TRANSFER BOVINE EMBRYOS GENERATED FROM FIBROBLASTS GENETICALLY MODIFIED BY piggyBac TRANSPOSITION

2015 ◽  
Vol 27 (1) ◽  
pp. 266
Author(s):  
A. Alessio ◽  
A. Fili ◽  
D. Forcato ◽  
M. F. Olmos-Nicotra ◽  
F. Alustiza ◽  
...  
Keyword(s):  
Fetal Development ◽  
Nuclear Transfer ◽  
Fluorescent Protein ◽  
Genetically Modified ◽  
Bovine Genome ◽  
Control Group ◽  
Large Animal ◽  
Phenotypic Analysis ◽  
Fluorescence Excitation ◽  
Fetal Fibroblasts

Transposon-mediated transgenesis is a well-established tool for genome manipulation in small animal models. However, translation of this active transgenesis method to the large animal setting requires further investigation. We have previously demonstrated that a helper-independent piggyBac (PB) transposon system can efficiently transpose transgenes into the bovine genome [Alessio et al. 2014 Reprod. Domest. Anim. 49 (Suppl. 1), 8]. The aims of the current study were a) to investigate the effectiveness of a hyperactive version of the PB transposase, and b) to determine the ability of the genetically modified cells to support early embryo and fetal development upon somatic cell nuclear transfer (SCNT). Bovine fetal fibroblasts (BFF) were chemically transfected with either pmGENIE-3 (a helper-independent PB transposon conferring genes for hygromycin resistance and enhanced green fluorescent protein (EGFP); Urschitz et al. 2010 PNAS USA 107, 8117–8122), pmhyGENIE-3 (carrying an hyperactive version of the PB transposase; Marh et al. 2012 PNAS USA 109, 19 184–19 189), or pmGENIE-3/Δ PB (a control plasmid lacking a functional PB transposase). Upon transfection, cell cultures were subjected to 14 days of hygromycin selection. Antibiotic-resistant and EGFP+ colonies were counted and data analysed by ANOVA and Tukey's test. For SCNT, pmhyGENIE-3 and pmGENIE-3 polyclonal cell lines were selected by FACS and individual cells used as nuclear donors. Day 7 blastocysts were nonsurgically transferred to synchronized recipients. Conceptuses were recovered by Day 35 of gestation, observed under fluorescence excitation, and genotyped. The mean number of colonies in pmhyGENIE-3 group was significantly higher than those in pmGENIE-3 and the control group (324.0 ± 17.8 v. 100.0 ± 16.1 and 2.8 ± 0.8 respectively, n = 4–7; P < 0.05). The hyperactive transposase increased transgene integration efficiency 3.24 times compared with the conventional PB transposase. The SCNT and early fetal development data are summarised in Table 1. Phenotypic analysis revealed that both transgenic fetuses and the extraembryonic membranes expressed EGFP with no macroscopic evidence of variegated transgene expression. Molecular analysis by PCR confirmed that both fetuses carried the transposon DNA. Here, we demonstrate that a hyperactive version of the PB transposase is more active in bovine cells than the conventional PB transposase. In addition, SCNT embryos generated from genetically modified cells by the pGENIE transposon system can progress to early stages of fetal development. Table 1.SCNT and early fetal development of bovine fibroblasts transposed with piggyBac1 The financial support of UNRC, CONICET and ANPCyT from Argentina is gratefully acknowledged.

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

2012 ◽  
Vol 24 (1) ◽  
pp. 141
Author(s):  
Z. W. Wang ◽  
P. Zhang ◽  
S. Zhang ◽  
X. Ma ◽  
Y. P. Yin ◽  
...  
Keyword(s):  
Histone Deacetylase ◽  
Nuclear Transfer ◽  
Expression Vector ◽  
Mrna Level ◽  
Negative Control ◽  
Control Group ◽  
Fibroblast Cells ◽  
Control Vector ◽  
Histone Deacetylase 1 ◽  
Donor Cells

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

scholarly journals 39 FACTORS INFLUENCING THE EFFICIENCY OF GENERATING GENETICALLY ENGINEERED PIGS BY NUCLEAR TRANSFER: MULTI-FACTORIAL ANALYSIS OF A LARGE DATA SET

2013 ◽  
Vol 25 (1) ◽  
pp. 167 ◽  
Author(s):  
M. Kurome ◽  
L. Geistlinger ◽  
B. Kessler ◽  
V. Zakhartchenko ◽  
N. Klymiuk ◽  
...  
Keyword(s):  
Gene Transfer ◽  
Gene Targeting ◽  
Nuclear Transfer ◽  
Large Data ◽  
Genetically Engineered ◽  
Kidney Cells ◽  
Data Set ◽  
Large Data Set ◽  
Fetal Fibroblasts ◽  
Additive Gene

Somatic cell nuclear transfer (SCNT) using genetically engineered donor cells is currently the most widely used strategy to generate genetically tailored pig models for biomedical research. Although this approach facilitates a similar spectrum of genetic modifications as in rodent models, including inducible transgene expression and gene targeting, the outcome in terms of live cloned piglets is quite variable. We used a large data set from 274 SCNT experiments (in total, 18 649 reconstructed embryos transferred into 193 recipients), performed over a period of 3 years, and evaluated it by multivariate analysis for combined assessment of multiple factors and their relative contribution to the efficiency of generation of genetically modified cloned pigs. Specifically, we addressed the effects of season, type of genetic modification (additive gene transfer v. gene targeting), donor cell source (mesenchymal stem cells, postnatal fibroblasts, fetal fibroblasts, and kidney cells), serial NT, and pre-selection of SCNT embryos for early development. Target parameters were pregnancy and delivery rates, as well as the numbers of born, live, and healthy offspring. Cloning efficiency was calculated as the number of cloned piglets relative to the number of transferred SCNT embryos. We used robust linear models adjusted to the underlying empirical distribution of the cloning outcome, as a straightforward approach to determine the statistically significant part of the network of factors affecting pig cloning. The SCNT experiments performed during the winter using fetal fibroblasts or kidney cells after additive gene transfer resulted in the highest number of live and healthy offspring, whereas sequential NT and NT experiments performed during the summer decreased it. Although the effects of individual factors may be different between various laboratories, the statistical approach described in this study may help to identify and optimize the most critical specific factors to cloning success in programs aimed at the generation of genetically engineered pig models. Supported by the DFG (FOR535, FOR793), the Bayerische Forschungsstiftung, and Mukoviszidose e.V.

36 CLONED BEAGLE DOGS DERIVED FROM FETAL FIBROBLASTS BY NUCLEAR TRANSFER

2008 ◽  
Vol 20 (1) ◽  
pp. 98 ◽  
Author(s):  
S. G. Hong ◽  
G. Jang ◽  
M. K. Kim ◽  
H. J. Oh ◽  
J. E. Park ◽  
...  
Keyword(s):  
Somatic Cell ◽  
Nuclear Transfer ◽  
Coat Color ◽  
Cell Types ◽  
Beagle Dogs ◽  
Black And White ◽  
Donor Cells ◽  
Fetal Fibroblasts ◽  
Identical Nucleus

Somatic cell nuclear transfer (SCNT) has been successfully performed in various mammals including sheep, cow, pig, and mouse using a variety of somatic cell types as nuclear donors. Several reports of livestock SCNT indicate that fetal fibroblasts are superior to adult fibroblasts as donor cells. In canine SCNT, however, only adult ear fibroblasts have been used as donor cells (Lee et al. 2005 Nature 436, 641; Jang et al. 2007 Theriogenology 67, 941–947). Accordingly, in the present study, we evaluated the ability of canine fetal fibroblasts to support fetal development to term after nuclear transfer. For SCNT, in vivo-matured oocytes flushed (approximately 72 h after ovulation) from the oviducts of six estrus females were used. Donor cells (fetal fibroblasts) were isolated from the fetus of a beagle bitch obtained at 28 days after artificial insemination. Before using fetal fibroblasts as donor cells, sex was determined by SRY gene detection using PCR. Oocytes were enucleated, microinjected with a female fetal fibroblast, fused by electrical stimulation, and activated chemically (Jang et al. 2007). A total of 50 cloned presumptive embryos were transferred (Day 0) into the oviducts of two naturally synchronous recipient bitches. One pregnancy, detected by ultrasonography on Day 23, was maintained to term and two healthy female puppies weighing 250 and 260 g were born by natural delivery on Day 60. They were genotypically identical to the donor cells, and had phenotypically similar black and white coat color patterns. Analysis of their mtDNA distribution showed that mtDNA in the two cloned beagles originated from one of the six oocyte donor dogs. In conclusion, our results demonstrate the potential of using fetal fibroblasts to facilitate nuclear transfer in the dog. The cloned beagle dogs, which had identical nucleus and mitochondrial DNA, will be provided for biomedical research as bioresources. This study was financially supported by KOSEF (grant # M10625030005-07N250300510) and the Korean MOE, through the BK21 program for Veterinary Science.

29 SCRIPTAID IMPROVES SOMATIC NUCLEAR TRANSFER EFFICIENCY DURING IN VITRO CULTURE OF PORCINE EMBRYOS DERIVED FROM INBRED MINIATURE PIG FETAL FIBROBLASTS

2015 ◽  
Vol 27 (1) ◽  
pp. 107
Author(s):  
R. Koppang ◽  
N. R. Mtango ◽  
M. Barcelo-Fimbres ◽  
J. P. Verstegen
Keyword(s):  
In Vitro Culture ◽  
Nuclear Transfer ◽  
Fibroblast Cell ◽  
Treated Group ◽  
Culture Conditions ◽  
Control Group ◽  
Miniature Pig ◽  
Fetal Fibroblasts ◽  
Blastocyst Rate

Porcine somatic cell nuclear transfer (SCNT) is limited to the same or next day surgical embryo transfer due to poor culture conditions in vitro. In this study, we aimed to overcome this problem by treating SCNT embryos with scriptaid, an inhibitor of histone deacetylase (HDACi) that helps with epigenetic reprogramming of the somatic nuclei. Scriptaid was chosen over other HDACi because it has been shown to improve histone acetylation in the same pattern as that of IVF embryos as well as its low toxicity characteristic (Zhao et al. 2009 Biol. Reprod. 81, 525–530; Zhao et al. 2010 Cell Reprogram. 12, 75–78). An inbred miniature pig fetal fibroblast cell line that is known to give low blastocyst rate in culture was used as a source of donor cells transferred into enucleated oocytes. Traditional SCNT was performed; embryos were fused and chemically activated in 10 µM ionomycin for 5 min and 2 mM DMAP for 3 to 4 h before being transferred into scriptaid. Embryos were treated with 500 nM scriptaid (Zhao et al. 2010) for 18 h and the untreated group was used as control. A total of 806 oocytes were used in 8 replicates. The constructed embryos were cultured in modified porcine zygote medium 5 (mPZM-5) for 7 days at 39°C in 5% O2, 5% CO2, 90% N2 atmosphere. Cleavage rates were assessed at 2.5 days and blastocyst rates at Day 7 after activation. Data were analysed by ANOVA using GLM, and percentages were transformed using arcsin square root using Statistix 10 software (Tallahassee, FL, USA). There were no differences in cleavage rates for control group v. scriptaid (55.3 v. 49.9%; P > 0.1; Table 1). The blastocyst rate per construct showed remarkable increase in the scriptaid treated group compared with the control group (12.8 v. 2.2%; P < 0.01; Table 1). Similarly, a significant effect was observed for blastocyst per embryos cleaved where scriptaid had higher rates compared with control (25.8 v. 5.8%; P < 0.01). These results indicated that improving nuclear reprogramming of miniature porcine SCNT clones by scriptaid treatment enhanced blastocyst production during the in vitro culture of porcine embryos. Table 1.Mean (± s.e.m.) measures of embryonic development of SCNT embryos

259 DNA HYPOMETHYLATION OF FETAL FIBROBLASTS IMPROVES DEVELOPMENTAL COMPETENCY AND GENE EXPRESSION PATTERN IN PORCINE EMBRYOS FOLLOWING NUCLEAR TRANSFER

2007 ◽  
Vol 19 (1) ◽  
pp. 246
Author(s):  
B. Mohana Kumar ◽  
H. F. Jin ◽  
J. G. Kim ◽  
S. A. Ock ◽  
H. J. Song ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Expression Pattern ◽  
Nuclear Transfer ◽  
Total Cell ◽  
Dna Hypomethylation ◽  
Developmental Potential ◽  
Expression Of Genes ◽  
Donor Cells ◽  
Fetal Fibroblasts

The inhibition of methyl groups in the DNA of donor cells has been hypothesized to improve the potential reprogramming by the enucleated ooplasm after nuclear transfer (NT). Previously, we reported that treatment of porcine fetal fibroblasts (PFF) with an inhibitor of methylation, 5-azacytidine (5-azaC) at 0.5 �m, results in the retention of desirable characteristics with a relative reduction in methylation, making cells more conducive for reprogramming (Mohana Kumar et al. 2006 Cell Tissue Res. 325, 445-454). To understand these observations further, the present study investigated the developmental competence and expression pattern of gene transcripts in porcine NT embryos from PFF (control) and 0.5 �m 5-azaC-treated PFF (PFF + 5-azaC) at 4-cell, 8-cell, morula, and blastocyst stages, and compared these with those of IVF and in vivo embryos. Cleavage rate was significantly (P &lt; 0.05) higher in IVF than in NT embryos from PFF and PFF + 5-azaC (86.7 � 5.2% vs. 65.8 � 5.3% and 69.3 � 4.4%, respectively). Similarly, significantly (P &lt; 0.05) higher blastocyst rates were observed in IVF embryos (27.2 � 2.1%). However, NT embryos from PFF + 5-azaC showed enhanced developmental potential with significantly (P &lt; 0.05) higher rates of blastocysts (21.3 � 2.2%) than NT embryos from PFF (14.8 � 1.9%). NT embryos from PFF + 5-azaC (33.8 � 4.1) had significantly (P &lt; 0.05) higher total cell numbers than from PFF (24.6 � 3.5), but did not differ in the proportion of apoptotic cells (6.9 � 1.8% and 7.2 � 2.1%, respectively). However, the high total cell number and lower incidence of apoptosis were observed in IVF and in vivo embryos (45.3 � 3.8, 2.7 � 0.8%, and 53.9 � 3.5, 1.2 � 0.9%, respectively). Alterations in the expression pattern of genes implicated in transcription and pluripotency (Oct4 and Stat3), DNA methylation (DNA methyltransferases: Dnmt1, Dnmt2, Dnmt3a, and Dnmt3b), histone acetylation (histone acetyltransferase 1-HAT1), and histone deacetylation (histone deacetylases-Hdac1, Hdac2, and Hdac3) were observed in NT embryos from PFF and PFF + 5-azaC compared with that in IVF and in vivo counterparts. However, the expression of genes in PFF + 5-azaC-NT embryos closely followed those of in vivo-derived embryos compared with PFF-NT embryos, and, interestingly, there was lower variability in the expression of genes related to DNA methylation. Our findings demonstrate that remodeling of the epigenetic status by partial reduction of somatic DNA methylation from donor cells is beneficial in improving the developmental competency of porcine NT embryos. Further, hypomethylated donors may be more efficiently reprogrammed to re-activate the expression of early embryonic genes. This work was supported by Grant No. R05-2004-000-10702-0 from KOSEF, Republic of Korea.

Sign in / Sign up

Export Citation Format

Share Document