scholarly journals 57 INVESTIGATION OF CYNOMOLGUS MONKEY (MACACA FASCICULARIS) FETUS FIBROBLAST CELL NUCLEAR TRANSFER

2005 ◽  
Vol 17 (2) ◽  
pp. 178
Author(s):  
J. Narita ◽  
H. Tsuchiya ◽  
T. Takada ◽  
R. Torii
Keyword(s):  
Embryo Development ◽  
Cynomolgus Monkey ◽  
Nuclear Transfer ◽  
Es Cells ◽  
Fibroblast Cells ◽  
Post Injection ◽  
Embryo Production ◽  
Cell Stage ◽  
Donor Cells ◽  
Whole Mount

Use of nuclear transfer (NT) in the cynomolgus monkey to establish tailor-made ES cells with the final goal of cloned embryo production was investigated. Activation stimulus conditions previously confirmed in parthenote production were used. Injection method NT was conducted using cynomolgus monkey fetus fibroblast cells in order to investigated the time it takes, from injection to activation, to reprogram the donor nuclei. Oocytes were collected under laparoscopic observation from mature cynomolgus monkeys 40 h after hCG (400 IU/kg) administration 9 days after follicle stimulation by i.m. injection of FSH (25 IU/kg). Donor cells, 40-day-old fetus fibroblast cells, were cultivated and synchronized at G0/G1 phase. After mature (MII) oocytes were enucleated using a Piezo-drive unit, donor cells were injected. At 2 h (Experiment 1, E1) and 4 h (Experiment 2, E2) after donor cell injection, activation was carried out by 2-min treatment with ionomycin and cultivation by 6-dimethylaminopurine for 4 h. As a control, parthenote production was carried out under the same activation conditions as NT. After activation, in vitro culture was carried out for about 9 days under conditions of 38°C, 5% CO2, and 5% O2. Whole-mount specimens of NT embryos were made immediately post-injection, 2 and 4 h post-injection, and 2 h after activation. Pronuclear formation (PN) and cleavage rates of NT embryos were 82.1% and 95.7% for E1, and 53.8% and 92.8% for E2, respectively. Control PN and cleavage rates were each 100%. Subsequent embryo development arrested at the 6-cell stage (8.7%) in E1 and 5-cell stage (7.1%) in E2 but proceeded to blastocyst stage (27.3%) in the control. For whole mount specimens, donor nuclei caused premature chromosome condensation in enucleated oocyte cytoplasm, and decondensation due to activation was seen, so injected donor nuclei reconstruction had occurred. No difference was seen between E2 and E1 embryo development and whole mount specimens, but E1 PN rate was clearly higher than that of E2. So 2 h of reprogramming time is more appropriate than 4 h. In this study, most NT embryos arrested at the 4-cell stage. These results suggest that development did not proceed beyond MET (maternal-embryonic transition) which is believed to occur between the 4- and 8-cell stage in cynomolgus monkey. Further study will be necessary to find the condition that completely reprograms injected donor nuclei for cloned embryo production. Table 1. Development of cynomolgus monkey fibroblast nuclear transfer embryos This work was supported by grants from the ministry of Education, Science, Sports, and Culture (13358014, 14380382).

39 DEVELOPMENTAL COMPETENCE OF RECONSTRUCTED EMBRYOS PRODUCED BY NUCLEAR TRANSFER BETWEEN CYNOMOLGUS MONKEY FIBROBLAST CELLS AND RABBIT OOCYTES

2006 ◽  
Vol 18 (2) ◽  
pp. 128 ◽  
Author(s):  
Y. Hosoi ◽  
T. Yamochi ◽  
N. Kawata ◽  
M. Takenoshita ◽  
S. Ohta ◽  
...  
Keyword(s):  
Cynomolgus Monkey ◽  
Nuclear Transfer ◽  
Culture Media ◽  
Genetic Material ◽  
Blastocyst Stage ◽  
Developmental Competence ◽  
Fibroblast Cells ◽  
Cell Stage ◽  
Reconstructed Embryos ◽  
Donor Cells

Interspecies nuclear transfer has been used as an invaluable tool for studying nucleus-cytoplasm interactions and it may also be used for rescuing endangered species whose oocytes are difficult to obtain. In this study, we investigated interaction of the cynomolgus monkey cell as a nuclear donor with the rabbit oocyte as a host cytoplasm. Whole cynomolgus fibroblast cells were injected into the rabbit enucleated oocytes (cynomolgus-rabbit cloned embryos) and cultured in TCM-199 and RPMI 1640 culture media. Rabbit-rabbit cloned embryos we used as control in this study. Karyotype analyses confirmed that genetic material of blastocysts was derived from the cynomolgus donor cells at blastocyst stage. Mitochondrial constitution analysis of the cynomolgus-rabbit cloned embryos indicated that mitochondria from both donor cells and enucleated oocytes coexisted. After culture for 168 h post-nuclear transfer, all cynomolgus-rabbit cloned embryos in TCM-199 were arrested at the 8-cell stage, but some of them developed to the blastocyst stage in RPMI 1640 (11/59, 18.6%). In this experiment, the nutrition requirement in vitro and the cleavage rate at each 24 h were examined. When TCM-199 was supplemented with lactate, some of these embryos developed to the blastocyst stage (15.3%, 2/13). This means that cynomolgus-rabbit cloned embryos might be controlled by the donor nucleus even in these early developmental stages. However, the timing of cleavage of cynomolgus-rabbit cloned embryos is very similar to that of the rabbit-rabbit cloned embryos. Time of cleavage may depend on the protein accumulated in the cytoplasm. In the prolonged culture of reconstructed embryos on feeder cells, adhesion cells were observed. These cells are also very similar to the cells derived from cynomolgus embryos by the same method. Our results suggest that: (1) a cynomolgus nucleus can co-ordinate with rabbit oocyte cytoplasm in early embryo development, (2) the 8- to 16-cell stage block in the cynomolgus-rabbit cloned embryos may due to the same reason as that in the cynomolgus embryos, and (3) ooplasmic factors that control time of cleavage are highly conservative between the species.

294 PRODUCTION AND CHARACTERIZATION OF PUTATIVE NUCLEAR TRANSFER EMBRYONIC STEM CELLS DERIVED FROM HANDMADE CLONED EMBRYOS USING EMBRYONIC STEM CELLS, LYMPHOCYTES, AND ADULT FIBROBLAST CELLS AS DONOR CELLS IN GOAT

2011 ◽  
Vol 23 (1) ◽  
pp. 244
Author(s):  
R. Dutta ◽  
D. Malakar ◽  
K. Khate ◽  
J. Akshay
Keyword(s):  
Stem Cells ◽  
Embryonic Stem Cells ◽  
Nuclear Transfer ◽  
Es Cells ◽  
Embryonic Stem ◽  
Donor Cell ◽  
Patient Specific ◽  
Fibroblast Cells ◽  
Donor Cells ◽  
Adult Fibroblasts

The handmade cloning technique has been a relatively recent addition in the field of nuclear transfer. In the present study, attempts were made to efficiently derive stem cells from handmade cloned (HMC) embryos in goat using adult fibroblast cells, embryonic stem (ES) cells, and lymphocytes as donor cells, and to characterise the derived putative nuclear transfer ES (ntES) cells for their stemness. Efficiency of the donor cells for nuclear transfer was also compared, and an overall cleavage and morula formation rates of 62.44 ± 3.9% and 35.30 ± 3.86%, 75.45 ± 3.92% and 45.84 ± 3.86%, and 56.38 ± 3.92% and 29.09 ± 3.86% were obtained from adult fibroblasts, ES cells, and lymphocytes, respectively. A significant difference was found between ES cells and the other 2 donor cells in terms of cleavage and morula formation. However, no such difference existed between fibroblasts and lymphocyte donor cells. Stem cell colonies were successfully derived from HMC embryos obtained from all 3 different donor cells. The rate of primary colony formation was 61.66 ± 4.62% for fibroblast-donor-cell-derived embryos. This rate was 59.91 ± 4.62% for ES-donor-cell-derived embryos and 62.49 ± 4.62% for lymphocyte-donor-cell-derived embryos. The putative ntES colonies were positively characterised for TRA-1-60, TRA-1-81, SSEA-1, SSEA-4, OCT-4, SOX-2, and Nanog by immunocytochemistry and RT-PCR. Results indicated that ES cells had better efficiency as donor cells in cloned embryo production than did adult fibroblasts and lymphocytes. The finding also suggested that terminally differentiated cell-like lymphocytes can also be reprogrammed. Moreover, there was no difference between the different donor-cell-derived HMC embryos in terms of ntES cell derivation. The study has established an efficient protocol for putative ntES cell derivation from HMC embryos. This could be of substantial significance because patient-specific ntES cells have proven therapeutic significance. The authors acknowledge N.D.R.I for the financial and infrastructural assistance.

In vitro development of mouse somatic nuclear transfer embryos: effects of donor cell passages and electrofusion

Zygote ◽  
2008 ◽  
Vol 16 (3) ◽  
pp. 223-227 ◽  
Author(s):  
Gang Zhang ◽  
Qing-Yuan Sun ◽  
Da-Yuan Chen
Keyword(s):  
Nuclear Transfer ◽  
Donor Cell ◽  
Fibroblast Cells ◽  
Negative Effects ◽  
Cell Stage ◽  
Kunming Mouse ◽  
Donor Cells ◽  
Significant Difference ◽  
Developmental Rates

SummaryIn this study, C57BL/6 adult male mouse ear fibroblast cells and Kunming mouse M2 oocytes were used as donors and recipients, respectively, to investigate the effect of passage number on donor cells and electrofusion times on the in vitro development of nuclear transfer (NT) embryos. The results demonstrated firstly that when the ear fibroblast cells from either 2–4, 5–7 or 8–10 passages were used as donors, respectively, to produce NT embryos, the number of passages undergone by the donor cells had no significant effect on the in vitro development of NT embryos. The developmental rates for morula/blastocyst were 15.2, 13.3 and 14.0%, respectively, which were not significantly difference (p > 0.05). Secondly, when the NT embryos were electrofused, there was no significant difference between the fusion ratio for the first electrofusion and the second electrofusion (p > 0.05). The developmental rates of the 2-cell and 4-cell stages that had undergone only one electrofusion, however, were significantly higher than those that had had two electrofusions (65.7% compared with 18.4% and 36.4% compared with 6.1%; p < 0.01), furthermore the NT embryos with two electrofusions could not develop beyond the 4-cell stage. This study suggests that this protocol might be an alternative method for mouse somatic cloning, even though electrofusion can exert negative effects on the development of NT embryos.

scholarly journals Manipulating the Mitochondrial Genome To Enhance Cattle Embryo Development

2017 ◽  
Vol 7 (7) ◽  
pp. 2065-2080 ◽  
Author(s):  
Kanokwan Srirattana ◽  
Justin C St. John
Keyword(s):  
Embryo Development ◽  
Nuclear Transfer ◽  
Bos Taurus ◽  
Trichostatin A ◽  
Donor Cell ◽  
Blastocyst Stage ◽  
Genetic Integrity ◽  
Rna Seq ◽  
Mtdna Copy Number ◽  
Donor Cells

Abstract The mixing of mitochondrial DNA (mtDNA) from the donor cell and the recipient oocyte in embryos and offspring derived from somatic cell nuclear transfer (SCNT) compromises genetic integrity and affects embryo development. We set out to generate SCNT embryos that inherited their mtDNA from the recipient oocyte only, as is the case following natural conception. While SCNT blastocysts produced from Holstein (Bos taurus) fibroblasts were depleted of their mtDNA, and oocytes derived from Angus (Bos taurus) cattle possessed oocyte mtDNA only, the coexistence of donor cell and oocyte mtDNA resulted in blastocysts derived from nondepleted cells. Moreover, the use of the reprogramming agent, Trichostatin A (TSA), further improved the development of embryos derived from depleted cells. RNA-seq analysis highlighted 35 differentially expressed genes from the comparison between blastocysts generated from nondepleted cells and blastocysts from depleted cells, both in the presence of TSA. The only differences between these two sets of embryos were the presence of donor cell mtDNA, and a significantly higher mtDNA copy number for embryos derived from nondepleted cells. Furthermore, the use of TSA on embryos derived from depleted cells positively modulated the expression of CLDN8, TMEM38A, and FREM1, which affect embryonic development. In conclusion, SCNT embryos produced by mtDNA depleted donor cells have the same potential to develop to the blastocyst stage without the presumed damaging effect resulting from the mixture of donor and recipient mtDNA.

scholarly journals Formation of nucleoli in interspecies nuclear transfer embryos derived from bovine, porcine, and rabbit oocytes and nuclear donor cells of various species

Reproduction ◽  
2011 ◽  
Vol 141 (4) ◽  
pp. 453-465 ◽  
Author(s):  
Irina Lagutina ◽  
Valeri Zakhartchenko ◽  
Helena Fulka ◽  
Silvia Colleoni ◽  
Eckhard Wolf ◽  
...  
Keyword(s):  
Nuclear Transfer ◽  
De Novo ◽  
Mammalian Species ◽  
Housekeeping Genes ◽  
Cell Stage ◽  
Whole Process ◽  
Embryonic Genome ◽  
Donor Nucleus ◽  
Donor Cells ◽  
Genome Activation

The most successful development of interspecies somatic cell nuclear transfer (iSCNT) embryos has been achieved in closely related species. The analyses of embryonic gene activity in iSCNT embryos of different species combinations have revealed the existence of significant aberrations in expression of housekeeping genes and genes dependent on the major embryonic genome activation (EGA). However, there are many studies with successful blastocyst (BL) development of iSCNT embryos derived from donor cells and oocytes of animal species with distant taxonomical relations (inter-family/inter-class) that should indicate proper EGA at least in terms of RNA polymerase I activation, nucleoli formation, and activation of genes engaged in morula and BL formation. We investigated the ability of bovine, porcine, and rabbit oocytes to activate embryonic nucleoli formation in the nuclei of somatic cells of different mammalian species. In iSCNT embryos, nucleoli precursor bodies originate from the oocyte, while most proteins engaged in the formation of mature nucleoli should be transcribed from genes de novo in the donor nucleus at the time of EGA. Thus, the success of nucleoli formation depends on species compatibility of many components of this complex process. We demonstrate that the time and cell stage of nucleoli formation are under the control of recipient ooplasm. Oocytes of the studied species possess different abilities to support nucleoli formation. Formation of nucleoli, which is a complex but small part of the whole process of EGA, is essential but not absolutely sufficient for the development of iSCNT embryos to the morula and BL stages.

24 EFFECTS OF HISTONE METHYLATION RELATED GENES ON EPIGENETIC REPROGRAMMING AND ZYGOTIC GENE ACTIVATION IN OVINE SOMATIC CELL NUCLEAR TRANSFER (SCNT) EMBRYOS

2009 ◽  
Vol 21 (1) ◽  
pp. 112
Author(s):  
I. Choi ◽  
K. H. S. Campbell
Keyword(s):  
Cell Cycle ◽  
Somatic Cell ◽  
Embryo Development ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Gene Activation ◽  
Early Embryo ◽  
Cell Stage ◽  
Early Embryo Development ◽  
Zygotic Gene

After fertilization, early embryo development is dependent upon maternally inherited proteins and protein synthesised from maternal mRNA until zygotic gene activation (ZGA) occurs. The transition of transcriptional activity from maternal to embryonic control occurs with the activation of rRNA genes and the formation of the nucleolus at the 8- to 16-cell stage that coincides with a prolonged fourth cell cycle in bovine and ovine embryos. However, previous studies have reported a shift in the longest cell cycle (fifth cell cycle) in bovine somatic cell nuclear transfer (SCNT) embryos, suggesting that the major genome activation is delayed, possibly due to incomplete changes in chromatin structure such as hypermethylation and hypoacetylation of histone (Memili and First 2000 Zygote 8, 87–96; Holm et al. 2003 Cloning Stem Cells 5, 133–142). Although global gene expression profile studies have been carried out in somatic cell nuclear transfer embryos, little is known about the expression of genes which can alter chromatin structure in early embryo development and possibly effect ZGA. To determine whether epigenetic reprogramming of donor nuclei affected ZGA and expression profiles in SCNT embryos, ZBTB33 (zinc finger and BTB domain containing 33, also known as kaiso, a methy-CpG specific repressor), BRG1(brahma-related gene 1, SWI/SNF family of the ATP-dependent chromatin remodeling complexes), JMJD1A (jumonji domain containing 1A, H3K9me2/1-specific demethylase), JMJD1C (putative H3K9-specific demethylase), and JMJD2C (H3K9me3-specific demethylase) were examined by RT-PCR at different developmental stages [germinal vesicle (GV), metaphase II (MII), 8- to 16-cell, 16- to 32-cell, and blastocyst in both parthenogenetic and SCNT embryos]. All genes were detected in parthenogenetic and SCNT blastocyts, and ZBTB33 was also expressed in all embryos at all stages tested. However, the onset of expression of JMJD1C, containing POU5F1 binding site at 5′-promoter region and BRG1 required for ZGA are delayed in SCNT embryos as compared to parthenotes (16- v. 8-cell, and blastoocyst v. 16-cell stage). Furthermore, JMJD2C containing NANOG binding sites at the 3′-flanking region was expressed in GV and MII oocytes and parthenogenetic blastocysts, whereas in SCNT embryos, JMJD2C was only observed from the 16-cell stage onwards. Interestingly, JMJD1A, which is positively regulated by POU5F1, was not detected in GV and MII oocytes but was present in blastocyst stage embryos of both groups. Taken together, these results suggest that incomplete epigenetic modifications of genomic DNA and histones lead to a delayed onset of ZGA which may affect further development and establishment of totipotency. Subsequently, aberrant expression patterns reported previously in SCNT embryos may be attributed to improper expression of histone H3K9 and H3K4 demethylase genes during early embryo development.

290 A CYNOMOLGUS MONKEY EMBRYONIC STEM CELL LINE DERIVED FROM A SINGLE BLASTOMERE

2008 ◽  
Vol 20 (1) ◽  
pp. 224
Author(s):  
J. Okahara-Narita ◽  
J. Yamasaki ◽  
C. Iwatani ◽  
H. Tsuchiya ◽  
K. Wakimoto ◽  
...  
Keyword(s):  
Cell Line ◽  
Cell Lines ◽  
Cynomolgus Monkey ◽  
Es Cells ◽  
Embryonic Stem ◽  
Es Cell ◽  
Cell Stage ◽  
Vitro Assay ◽  
Single Blastomere ◽  
Cell Colony

The establishment of most embryonic stem (ES) cell lines requires the destruction of embryos. Some ES cell lines in mice and humans are currently derived from a single blastomere, so that remaining blastomeres can still develop into fetuses. However, the procedures currently in use for establishing these lines are very complicated, and other ES cell lines from the same species are needed (Chung et al. 2006 Nature 439, 216–219; Klimanskaya et al. 2006 Nature 444, 481–485). The objective of this study was to devise a method simpler than those previously described for establishing ES cell lines from a single blastomere in the cynomolgus monkey. Controlled ovarian stimulation and oocyte recovery have been described previously by Torii et al. (2000 Primates 41, 39–47). Cumulus-free mature oocytes were fertilized by intracytoplasmic sperm injection (ICSI), and then cultured at 38�C in 5% CO2, 5% O2 for 2 days. The zona pellucida of 4- to 5-cell-stage embryos was disrupted using acidic Tyrode's solution, and individual blastomeres were separated from the denuded embryos using trypsin. These blastomeres were cultured on mitomycin-C-treated mouse embryonic fibroblasts and ES medium containing adrenocorticotropic hormone (ACTH) (Ogawa et al. 2004 Genes to Cells 9, 471–477). After the formation of initial outgrowths, half of the medium was changed every other day until the outgrowths reached approximately 100 cells. Passage of putative monkey ES cells was performed by mechanical dispersion of the colonies and transfer to fresh feeders every 3–4 days until there were enough cells for enzymatic dispersion. One stable ES cell line was obtained from two 4- or 5-cell-stage embryos using ES medium containing ACTH. The morphology of this ES cell colony was consistent with the monkey ES cell colony previous described by Suemori et al. (2001 Dev. Dynamics 222, 273–279). The ES cell line was passaged more than 17 times, and the morphology of the ES cell colony did not differ between the first and seventeenth passages. The ES cells showed normal karyotype and retained pluripotency markers for primate ES cells including octamer-binding protein 4 (Oct-4), stage-specific embryonic antigen (SSEA)-4, tumor-rejection antigen (TRA)-1-60, and TRA-1-81. We are presently confirming whether this ES cell line possesses potencies to differentiate in all three embryonic germ layers using both an in vitro assay and teratoma formation. Here we showed that cynomolgus monkey ES cells can be derived from a single blastomere, without co-culturing another ES cell line, as has been done in previous studies on mice and humans. This method allows the establishment of ES cell lines from a single blastomere, leaving the other blastomeres available for embryo transfer. Thus, the method described here is simpler than previously described methods and alleviates some ethical concerns.

29 TREATMENT OF DONOR CELLS WITH XENOPUS OOCYTE EXTRACT ENHANCED SOMATIC CELL NUCLEAR TRANSFER EMBRYO DEVELOPMENT

2012 ◽  
Vol 24 (1) ◽  
pp. 126
Author(s):  
X. Yang ◽  
J. Mao ◽  
E. M. Walters ◽  
M. T. Zhao ◽  
K. Lee ◽  
...  
Keyword(s):  
Somatic Cell ◽  
Embryo Development ◽  
Natural Science ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Control Group ◽  
Blastocyst Formation ◽  
Donor Cells ◽  
Fetal Fibroblasts ◽  
Frog Oocyte

Somatic cell nuclear transfer (SCNT) efficiency in pigs and other species is still very low. This low efficiency and the occurrence of developmental abnormalities in offspring has been attributed to incomplete or incorrect reprogramming. Cytoplasmic extracts from both mammalian and amphibian oocytes can alter the epigenetic state of mammalian somatic nuclei as well as gene expression to more resemble that of pluripotent cells. Rathbone et al. (2010) has showed that pretreating somatic donor cells with frog oocyte extract (FOE) increased live birth in ovine. Liu et al. (2011) also reported that treating donor cells with FOE enhanced handmade clone embryo development in pigs. The aim of this study was to evaluate the early development of cloned embryos produced with porcine GFP fibroblasts pre-treated with a permeabilizing agent, digitonin and matured frog oocyte extract. Frog egg cytoplasmic extract was prepared from one frog's oocytes after being matured in vitro to MII stage. The experiment included 2 groups. In the FOE-treated group, GFP-tagged fetal fibroblasts were permeabilized by digitonin (15 ng mL–1) and incubated in FOE containing an ATP-regenerating system (2.5 mM ATP, 125 μM GTP, 62.5 μg mL–1 of creatine kinase, 25 mM phosphocreatine and 1 mM NTP) at room temperature (24°C) for 2 h; cell membranes were re-sealed by culturing in 10% FBS in DMEM media for 2.5 h at 38.5°C before used as donor cells. In the control group, the same donor cells were treated with digitonin, but without frog oocyte extract incubation. The SCNT embryos were produced by using the 2 groups of donor cells as described above. In total, 305 control and 492 FOE oocytes were enucleated from 8 biological replicates. Two hundred fifty control and 370 FOE couplets were fused and cultured in porcine zygote medium 3. Percent cleavage was recorded on Day 2 and the percent blastocyst formation was determined on Day 7 (SCNT day = 0). In addition, the number of nuclei in the blastocysts was recorded on Day 7. Percent fusion, cleavage, blastocyst formation and number of nuclei in blastocysts were analysed by using SAS software (v9.2), with day and treatment class as main effects. There was no difference in percent fusion (FOE, 76.2 ± 2.5% vs control, 80.8 ± 2.8%) or in cleavage (FOE: 74.8 ± 2.5% vs control: 74.6 ± 2.9%). Only green blastocysts with 16 or more nuclei were considered to be a true SCNT blastocyst. The percent blastocyst was higher in the FOE group than that in the control (13.9 ± 0.8% vs 9.5 ± 0.9%, P < 0.05), whereas the number of nuclei in the blastocysts was not different between the 2 groups (39.7 ± 2.4, 35.9 ± 3.8 for FOE and control, respectively). In conclusion, our study demonstrated that pre-treatment of donor cells with digitonin and Xenopus MII oocyte extract increased porcine SCNT embryo development to blastocyst and cloning efficiency. Funded by the National Natural Science Foundation of China (NO. 31071311), Natural Science Foundation of Fujian Province of China (No. 2009J06017) and NIH U42 RR18877.

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

2012 ◽  
Vol 24 (1) ◽  
pp. 141
Author(s):  
Z. W. Wang ◽  
P. Zhang ◽  
S. Zhang ◽  
X. Ma ◽  
Y. P. Yin ◽  
...  
Keyword(s):  
Histone Deacetylase ◽  
Nuclear Transfer ◽  
Expression Vector ◽  
Mrna Level ◽  
Negative Control ◽  
Control Group ◽  
Fibroblast Cells ◽  
Control Vector ◽  
Histone Deacetylase 1 ◽  
Donor Cells

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

500. THE MANIPULATION OF THE EPIGENETIC MARK HISTONE 3 LYSINE 9 TRIMETHYLATION IN DONOR CELLS AND ITS EFFECTS ON THE DEVELOPMENT OF CLONED MOUSE EMBRYOS

2009 ◽  
Vol 21 (9) ◽  
pp. 101
Author(s):  
J. Antony ◽  
F. Oback ◽  
R. Broadhurst ◽  
S. Cole ◽  
C. Graham ◽  
...  
Keyword(s):  
Gene Expression ◽  
Nuclear Transfer ◽  
Expression Profiles ◽  
Es Cells ◽  
Embryonic Stem ◽  
Histone Demethylase ◽  
Specific Gene ◽  
Epigenetic Mark ◽  
Epigenetic Marks ◽  
Donor Cells

To produce live cloned mammals from adult somatic cells the nuclei of these cells must be first reprogrammed from a very restricted, cell lineage-specific gene expression profile to an embryo-like expression pattern, compatible with embryonic development. Although this has been achieved in a number of species the efficiency of cloning remains very low. Inadequate reprogramming of epigenetic marks in the donor cells correlated with aberrant embryonic gene expression profiles has been identified as a key cause of this inefficiency. Some of the most common epigenetic marks are chemical modifications of histones, the main structural proteins of chromatin. A range of different histone modifications, including acetylation and methylation, exists and can be attributed to either repression or activation of genes. One epigenetic mark which is known to be very stable and difficult to remove during reprogramming is the trimethylation of lysine 9 in histone H3 (H3K9Me3). To test the hypothesis that H3K9Me3 marks are a major stumbling block for successful cloning we are attempting to remove these marks by overexpression of the H3K9Me3 specific histone demethylase, jmjd2b, in donor cells, prior to their use for nuclear transfer. We have engineered mouse embryonic stem (ES) cells for the tet inducible expression of a fusion protein with a functional jmjd2b or non-functional mutant jmjd2b histone demethylase. Approximately 94% and 88% of the cells can be induced for the expression of functional and mutant jmjd2b-EGFP in the respective ES cell lines. Immunofluorescence analyses have shown that induction of functional jmjd2b-EGFP results in an approximately 50% reduction of H3K9Me3 levels compared to non-induced cells and induced mutant jmjd2b-EGFP cells. The comparison of the in-vitro embryo development following nuclear transfer with induced and non-induced donor cells show significantly better overall development to blastocysts and morulae from induced donor cells with reduced H3K9Me3 levels.

Sign in / Sign up

Export Citation Format

Share Document