An Anionic, Stem-Specific Flax Peroxidase cDNA With C-Terminal Motifs Also Found in a Blue Copper-Type Pea Protein Correlated With Lignin Deposition

1996 ◽  
Vol 23 (6) ◽  
pp. 773 ◽  
Author(s):  
F Omann ◽  
H Tyson
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Catalytic Domain ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Specific Expression ◽  
Blue Copper ◽  
Linum Usitatissimum L ◽  
Plant Peroxidases ◽  
Lignin Deposition

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.

cDNA sequence and tissue-specific expression of an anionic flax peroxidase

Genome ◽  
1994 ◽  
Vol 37 (1) ◽  
pp. 137-147 ◽  
Author(s):  
Franz Omann ◽  
Normand Beaulieu ◽  
Hugh Tyson
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Pcr Amplification ◽  
Glycosylation Site ◽  
Northern Analysis ◽  
Sequence Comparisons ◽  
Specific Expression ◽  
Amino Acid Region ◽  
Linum Usitatissimum L ◽  
Plant Peroxidases

A flax (Linum usitatissimum L.) λgt10 cDNA library was screened with a probe coding for the amino terminus of a flax peroxidase. The probe was generated by PCR amplification of the library with one of the λgt10 sequencing primers and a mixed oligonucleotide derived from a well-conserved amino acid region (distal heme ligand) found in all plant peroxidases. A positive clone (FLXPER2) was isolated and characterized. The cDNA contains 1153 nucleotides, excluding the poly(A) tail, and encodes a mature protein of 297 amino acids with a molecular mass of 31.9 kDa. The mature protein's amino acid sequence contains three highly conserved regions, two of which contain histidine ligands for the heme group. The deduced amino acid sequence has nine cysteine residues. Eight are identically located to those of horseradish C peroxidase, which participate in four disulfide bridges; these cysteines are highly conserved in all plant peroxidases. One potential N-glycosylation site (Asn-X-Thr/Ser) is present. The predicted pI value of 4.5 identifies FLXPER2 as an anionic peroxidase. Northern blot analysis shows that its mRNA expression is unique to stem tissue. Amino acid sequence comparisons show high similarity between FLXPER2 and peanut, rice, and tobacco peroxidases.Key words: flax peroxidase cDNA, PCR, Northern analysis, sequence relationships.

scholarly journals Roles of the C-Terminal Amino Acids of Non-Hexameric Helicases: Insights from Escherichia coli UvrD

2021 ◽  
Vol 22 (3) ◽  
pp. 1018
Author(s):  
Hiroaki Yokota
Keyword(s):  
Escherichia Coli ◽  
Amino Acids ◽  
Amino Acid ◽  
Single Molecule ◽  
Underlying Mechanism ◽  
Amino Acid Sequences ◽  
E Coli ◽  
X Ray Crystallography ◽  
Terminal Amino

Helicases are nucleic acid-unwinding enzymes that are involved in the maintenance of genome integrity. Several parts of the amino acid sequences of helicases are very similar, and these quite well-conserved amino acid sequences are termed “helicase motifs”. Previous studies by X-ray crystallography and single-molecule measurements have suggested a common underlying mechanism for their function. These studies indicate the role of the helicase motifs in unwinding nucleic acids. In contrast, the sequence and length of the C-terminal amino acids of helicases are highly variable. In this paper, I review past and recent studies that proposed helicase mechanisms and studies that investigated the roles of the C-terminal amino acids on helicase and dimerization activities, primarily on the non-hexermeric Escherichia coli (E. coli) UvrD helicase. Then, I center on my recent study of single-molecule direct visualization of a UvrD mutant lacking the C-terminal 40 amino acids (UvrDΔ40C) used in studies proposing the monomer helicase model. The study demonstrated that multiple UvrDΔ40C molecules jointly participated in DNA unwinding, presumably by forming an oligomer. Thus, the single-molecule observation addressed how the C-terminal amino acids affect the number of helicases bound to DNA, oligomerization, and unwinding activity, which can be applied to other helicases.

Interactions of mouse glycophorin A with the dRTA-related mutant G719D of the mouse Cl–/HCO3– exchanger Ae1This paper is one of a selection of papers published in a Special Issue entitled CSBMCB 53rd Annual Meeting — Membrane Proteins in Health and Disease, and has undergone the Journal’s usual peer review process.

2011 ◽  
Vol 89 (2) ◽  
pp. 224-235 ◽  
Author(s):  
Andrew K. Stewart ◽  
Fouad T. Chebib ◽  
Syed W. Akbar ◽  
Maria J. Salas ◽  
Rajan A. Sonik ◽  
...  
Keyword(s):  
Amino Acids ◽  
Transmembrane Domain ◽  
Peer Review Process ◽  
Surface Expression ◽  
Amino Acid Sequences ◽  
Glycophorin A ◽  
Specific Expression ◽  
Health And Disease ◽  
Renal Tubular

The AE1 mutation G701D, associated with recessive distal renal tubular acidosis (dRTA), produces only minimal erythroid phenotype, reflecting erythroid-specific expression of stimulatory AE1 subunit glycophorin A (GPA). GPA transgene expression could theoretically treat recessive dRTA in patients and in mice expressing cognate Ae1 mutation G719D. However, human (h) GPA and mouse (m) Gpa amino acid sequences are widely divergent, and mGpa function in vitro has not been investigated. We therefore studied in Xenopus oocytes the effects of coexpressed mGpa and hGPA on anion transport by erythroid (e) and kidney (k) isoforms of wild-type mAe1 (meAe1, mkAe1) and of mAe1 mutant G719D. Coexpression of hGPA or mGpa enhanced the function of meAe1 and mkAe1 and rescued the nonfunctional meAe1 and mkAe1 G719D mutants through increased surface expression. Progressive N-terminal truncation studies revealed a role for meAe1 amino acids 22–28 in GPA-responsiveness of meAe1 G719D. MouseN-cyto/humanTMD and humanN-cyto/mouseTMD kAE1 chimeras were active and GPA-responsive. In contrast, whereas chimera mkAe1N-cyto/hkAE1 G701DTMD was GPA-responsive, chimera hkAE1N-cyto/mkAe1 G719DTMD was GPA-insensitive. Moreover, whereas the isolated transmembrane domain (TMD) of hAE1 G701D was GPA-responsive, that of mAe1 G719D was GPA-insensitive. Thus, mGpa increases surface expression and activity of meAe1 and mkAe1. However, the G719D mutation renders certain mAe1 mutant constructs GPA-unresponsive and highlights a role for erythroid-specific meAe1 amino acids 22–28 in GPA-responsiveness.

scholarly journals The amino acid sequence of cytochromes c-551 from three species of Pseudomonas

1973 ◽  
Vol 131 (3) ◽  
pp. 485-498 ◽  
Author(s):  
R. P. Ambler ◽  
Margaret Wynn
Keyword(s):  
Amino Acids ◽  
Pseudomonas Aeruginosa ◽  
Amino Acid ◽  
Cytochrome C ◽  
Amino Acid Sequence ◽  
Amino Acid Sequences ◽  
Mitochondrial Cytochrome ◽  
Cytochromes C ◽  
Lending Library ◽  
Single Peptide

The amino acid sequences of the cytochromes c-551 from three species of Pseudomonas have been determined. Each resembles the protein from Pseudomonas strain P6009 (now known to be Pseudomonas aeruginosa, not Pseudomonas fluorescens) in containing 82 amino acids in a single peptide chain, with a haem group covalently attached to cysteine residues 12 and 15. In all four sequences 43 residues are identical. Although by bacteriological criteria the organisms are closely related, the differences between pairs of sequences range from 22% to 39%. These values should be compared with the differences in the sequence of mitochondrial cytochrome c between mammals and amphibians (about 18%) or between mammals and insects (about 33%). Detailed evidence for the amino acid sequences of the proteins has been deposited as Supplementary Publication SUP 50015 at the National Lending Library for Science and Technology, Boston Spa, Yorks. LS23 7BQ, U.K., from whom copies can be obtained on the terms indicated in Biochem. J. (1973), 131, 5.

scholarly journals Functional Analysis of PA Binding by Influenza A Virus PB1: Effects on Polymerase Activity and Viral Infectivity

2001 ◽  
Vol 75 (17) ◽  
pp. 8127-8136 ◽  
Author(s):  
Daniel R. Perez ◽  
Ruben O. Donis
Keyword(s):  
Amino Acids ◽  
Influenza Virus ◽  
Amino Acid ◽  
Viral Replication ◽  
Influenza A Virus ◽  
Influenza A ◽  
Amino Acid Sequences ◽  
Influenza Viruses ◽  
Virus Growth ◽  
Transcription And Replication

ABSTRACT Influenza A virus expresses three viral polymerase (P) subunits—PB1, PB2, and PA—all of which are essential for RNA and viral replication. The functions of P proteins in transcription and replication have been partially elucidated, yet some of these functions seem to be dependent on the formation of a heterotrimer for optimal viral RNA transcription and replication. Although it is conceivable that heterotrimer subunit interactions may allow a more efficient catalysis, direct evidence of their essentiality for viral replication is lacking. Biochemical studies addressing the molecular anatomy of the P complexes have revealed direct interactions between PB1 and PB2 as well as between PB1 and PA. Previous studies have shown that the N-terminal 48 amino acids of PB1, termed domain α, contain the residues required for binding PA. We report here the refined mapping of the amino acid sequences within this small region of PB1 that are indispensable for binding PA by deletion mutagenesis of PB1 in a two-hybrid assay. Subsequently, we used site-directed mutagenesis to identify the critical amino acid residues of PB1 for interaction with PA in vivo. The first 12 amino acids of PB1 were found to constitute the core of the interaction interface, thus narrowing the previous boundaries of domain α. The role of the minimal PB1 domain α in influenza virus gene expression and genome replication was subsequently analyzed by evaluating the activity of a set of PB1 mutants in a model reporter minigenome system. A strong correlation was observed between a functional PA binding site on PB1 and P activity. Influenza viruses bearing mutant PB1 genes were recovered using a plasmid-based influenza virus reverse genetics system. Interestingly, mutations that rendered PB1 unable to bind PA were either nonviable or severely growth impaired. These data are consistent with an essential role for the N terminus of PB1 in binding PA, P activity, and virus growth.

Sequence and expression of the dCMP deaminase gene (DCD1) of Saccharomyces cerevisiae

1986 ◽  
Vol 6 (5) ◽  
pp. 1711-1721
Author(s):  
E M McIntosh ◽  
R H Haynes
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Amino Acids ◽  
Amino Acid ◽  
Amino Acid Sequences ◽  
Open Reading Frame ◽  
Northern Analysis ◽  
Hindiii Site ◽  
Reading Frame ◽  
Hindiii Restriction Site ◽  
Cycle Dependent

The dCMP deaminase gene (DCD1) of Saccharomyces cerevisiae has been isolated by screening a Sau3A clone bank for complementation of the dUMP auxotrophy exhibited by dcd1 dmp1 haploids. Plasmid pDC3, containing a 7-kilobase (kb) Sau3A insert, restores dCMP deaminase activity to dcd1 mutants and leads to an average 17.5-fold overproduction of the enzyme in wild-type cells. The complementing activity of the plasmid was localized to a 4.2-kb PvuII restriction fragment within the Sau3A insert. Subcloning experiments demonstrated that a single HindIII restriction site within this fragment lies within the DCD1 gene. Subsequent DNA sequence analysis revealed a 936-nucleotide open reading frame encompassing this HindIII site. Disruption of the open reading frame by integrative transformation led to a loss of enzyme activity and confirmed that this region constitutes the dCMP deaminase gene. Northern analysis indicated that the DCD1 mRNA is a 1.15-kb poly(A)+ transcript. The 5' end of the transcript was mapped by primer extension and appears to exhibit heterogeneous termini. Comparison of the amino acid sequence of the T2 bacteriophage dCMP deaminase with that deduced for the yeast enzyme revealed a limited degree of homology which extends over the entire length of the phage polypeptide (188 amino acids) but is confined to the carboxy-terminal half of the yeast protein (312 amino acids). A potential dTTP-binding site in the yeast and phage enzymes was identified by comparison of homologous regions with the amino acid sequences of a variety of other dTTP-binding enzymes. Despite the role of dCMP deaminase in dTTP biosynthesis, Northern analysis revealed that the DCD1 gene is not subject to the same cell cycle-dependent pattern of transcription recently found for the yeast thymidylate synthetase gene (TMP1).

scholarly journals The substrate specificity of adenosine 3′:5′-cyclic monophosphate-dependent protein kinase of rabbit skeletal muscle

1977 ◽  
Vol 162 (2) ◽  
pp. 411-421 ◽  
Author(s):  
S J Yeaman ◽  
P Cohen ◽  
D C Watson ◽  
G H Dixon
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Protein Kinase ◽  
Phosphorylation Site ◽  
Amino Acid Sequences ◽  
Beta Subunit ◽  
Alpha Subunit ◽  
Phosphorylase Kinase ◽  
Dependent Protein Kinase ◽  
Dependent Protein

The known amino acid sequences at the two sites on phosphorylase kinase that are phosphorylated by cyclic AMP-dependent protein kinase were extended. The sequences of 42 amino acids around the phosphorylation site on the alpha-subunit and of 14 amino acids around the phosphorylation site on the beta-subunit were shown to be: alpha-subunit Phe-Arg-Arg-Leu-Ser(P)-Ile-Ser-Thr-Glu-Ser-Glx-Pro-Asx-Gly-Gly-His-Ser-Leu-Gly-Ala-Asp-Leu-Met-Ser-Pro-Ser-Phe-Leu-Ser-Pro-Gly-Thr-Ser-Val-Phe(Ser,Pro,Gly)His-Thr-Ser-Lys; beta-subunit, Ala-Arg-Thr-Lys-Arg-Ser-Gly-Ser(P)-VALIle-Tyr-Glu-Pro-Leu-Lys. The sites on histone H2B which are phosphorylated by cyclic AMP-dependent protein kinase in vitro were identified as serine-36 and serine-32. The amino acid sequence in this region is: Lys-Lys-Arg-Lys-Arg-Ser32(P)-Arg-Lys-Glu-Ser36(P)-Tyr-Ser-Val-Tyr-Val- [Iwai, K., Ishikawa, K. & Hayashi, H. (1970) Nature (London) 226, 1056-1058]. Serine-36 was phosphorylated at 50% of the rate at which the beta-subunit of phosphorylase kinase was phosphorylated, and it was phosphorylated 6-7-fold more rapidly than was serine-32. The amino acid sequences when compared with those at the phosphorylation sites of other physiological substrates suggest that the presence of two adjacent basic amino acids on the N-terminal side of the susceptible serine residue may be critical for specific substrate recognition in vivo.

Die primäre Proteinstruktur von Stämmen des Tabakmosaikvirus

1963 ◽  
Vol 18 (12) ◽  
pp. 1032-1049 ◽  
Author(s):  
B. Wittmann-Liebold ◽  
H. G. Wittmann
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Tobacco Mosaic Virus ◽  
Mosaic Virus ◽  
Amino Acid Sequences ◽  
Tryptic Peptides

The amino acid sequence of dahlemense, a naturally occuring strain of tobacco mosaic virus, has been determined and compared with that of the strain vulgare (Fig. 7). In this communication the experimental details are given for the elucidation of the amino acid sequences within two tryptic peptides with 65 amino acids.

scholarly journals Analysis of Htra Gene from Zebrafish (Danio Rerio)

2015 ◽  
Vol 10 (2) ◽  
Author(s):  
M. Murwantoko ◽  
Chio Oka ◽  
Masashi Kawaichi
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Danio Rerio ◽  
Serine Proteases ◽  
Catalytic Domain ◽  
Fruit Fly ◽  
Wide Range ◽  
Igf Binding ◽  
Bacterial Homolog

HtrA which is characterized by the combination of a trypsin-like catalytic domain with at least one C-terminalPDZ domain is a highly conserved family of serine proteases found in a wide range of organisms. However theidentified HtrA family numbers varies among spesies, for example the number of mammalian, Eschericia coli,fruit fly-HtrA family are 4, 3 and 1 gene respectively. One gene is predicted exist in zebrafish. Since no completeinformation available on zebrafish HtrA, in this paper zebrafish HtrA (zHtrA) gene was analyzed. The zHtrA isbelonged to HtrA1 member and predicted encodes 478 amino acids with a signal peptide, a IGF binding domain,a Kazal-type inhibitor domain in the up stream of HtrA-bacterial homolog. At the amino acid sequence the zHtrA1showed the 69%, 69%, 68%, 54% and 54% with the rat HtrA1, mouse HtrA1, human HtrA1, human HtrA3 andmouse HtrA4 respectively. The zHtrA1 is firstly expressed at 60 hpf and mainly in the vertebral rudiments in thetail region.

Isolation and characterization of some novel genes of the apolipoprotein A-I family in Japanese eel, Anguilla japonica

2011 ◽  
Vol 6 (4) ◽  
pp. 545-557 ◽  
Author(s):  
Malay Choudhury ◽  
Takahiro Oku ◽  
Shoji Yamada ◽  
Masaharu Komatsu ◽  
Keita Kudoh ◽  
...  
Keyword(s):  
Amino Acids ◽  
Molecular Weight ◽  
Amino Acid ◽  
Consensus Sequence ◽  
Structural Features ◽  
Lipid Binding ◽  
Japanese Eel ◽  
Amino Acid Sequences ◽  
Novel Genes ◽  
Isolation And Characterization

AbstractApolipoproteins such as apolipoprotein (apo) A-I, apoA-IV, and apoE are lipid binding proteins synthesized mainly in the liver and the intestine and play an important role in the transfer of exogenous or endogenous lipids through the circulatory system. To investigate the mechanism of lipid transport in fish, we have isolated some novel genes of the apoA-I family, apoIA-I (apoA-I isoform) 1–11, from Japanese eel by PCR amplification. Some of the isolated genes of apoIA-I corresponded to 28kDa-1 cDNAs which had already been deposited into the database and encoded an apolipoprotein with molecular weight of 28 kDa in the LDL, whereas others seemed to be novel genes. The structural organization of all apoIA-Is consisted of four exons separated by three introns. ApoIA-I10 had a total length of 3232 bp, whereas other genes except for apoIA-I9 ranged from 1280 to 1441 bp. The sequences of apoIA-Is at the exon-intron junctions were mostly consistent with the consensus sequence (GT/AG) at exon-intron boundaries, whereas the sequences of 3′ splice acceptor in intron 1 of apoIA-I1-7 were (AC) but not (AG). The deduced amino acid sequences of all apoIA-Is contained a putative signal peptide and a propeptide of 17 and 5 amino acid residues, respectively. The mature proteins of apoIA-I1-3, 7, and 8 consisted of 237 amino acids, whereas those of apoIA-I4-6 consisted of 239 amino acids. The mature apoIA-I10 sequence showed 65% identity to amino acid sequence of apoIA-I11 which was associated with an apolipoprotein with molecular weight of 23 kDa in the VLDL. All these mature apoIA-I sequences satisfied the common structural features depicted for the exchangeable apolipoproteins such as apoA-I, apoA-IV, and apoE but apoIA-I11 lacked internal repeats 7, 8, and 9 when compared with other members of apoA-I family. Phylogenetic analysis showed that these novel apoIA-Is isolated from Japanese eel were much closer to apoA-I than apoA-IV and apoE, suggesting new members of the apoA-I family.

Sign in / Sign up

Export Citation Format

Share Document