scholarly journals Carbohydrate response element binding protein (ChREBP) modulates the inflammatory response of mesangial cells in response to glucose

2018 ◽  
Vol 38 (6) ◽  
Author(s):  
Yan Chen ◽  
Yan-Jun Wang ◽  
Ying Zhao ◽  
Jin-Cheng Wang
Keyword(s):  
Diabetes Mellitus ◽  
Inflammatory Response ◽  
Mesangial Cells ◽  
Binding Protein ◽  
The Body ◽  
Mrna Levels ◽  
Diabetic Mice ◽  
Response Element ◽  
Tnf Α ◽  
Element Binding Protein

Diabetic nephropathy (DN) is one of the most devastating complications of diabetes mellitus. Carbohydrate response element binding protein (ChREBP) is a basic helix–loop–helix leucine zipper transcription factor that primarily mediates glucose homeostasis in the body. The present study investigated the role of ChREBP in the pathogenesis of DN. The expression of ChREBP was detected in patients with type 2 diabetes mellitus (T2DM), diabetic mice, and mesangial cells. ELISA was used to measure cytokine production in mesangial cells. Flow cytometry analysis was performed to detect the apoptosis of mesangial cells in the presence of high glucose. The expression levels of ChREBP and several cytokines (TNF-α, IL-1β, and IL-6) were up-regulated in T2DM patients. The mRNA and protein levels of ChREBP were also significantly elevated in the kidneys of diabetic mice. Moreover, glucose treatment promoted mRNA levels of TNF-α, IL-1β, and IL-6 in mesangial cells. Glucose stimulation induced significant apoptosis of SV40 MES 13 cells. In addition, transfection with ChREBP siRNA significantly inhibited ChREBP expression. Consequently, the inflammatory responses and apoptosis were inhibited in SV40 MES 13 cells. These results demonstrated that ChREBP could mediate the inflammatory response and apoptosis of mesangial cells, suggesting that ChREBP may be involved in the pathogenesis of DN.

scholarly journals Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽  
2006 ◽  
Vol 147 (9) ◽  
pp. 4292-4302 ◽  
Author(s):  
Koshi Hashimoto ◽  
Masanobu Yamada ◽  
Shunichi Matsumoto ◽  
Tsuyoshi Monden ◽  
Teturou Satoh ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Retinoid X Receptor ◽  
Mrna Levels ◽  
Response Element ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

scholarly journals Cyclical Alternative Exon Splicing of Transcription Factor Cyclic Adenosine Monophosphate Response Element-Binding Protein (CREB) Messenger Ribonucleic Acid during Rat Spermatogenesis*

Endocrinology ◽  
1998 ◽  
Vol 139 (9) ◽  
pp. 3721-3729 ◽  
Author(s):  
Philip B. Daniel ◽  
Joel F. Habener
Keyword(s):  
Transcription Factor ◽  
Binding Protein ◽  
Alternative Exon ◽  
Seminiferous Tubules ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Response Element ◽  
Exon Splicing ◽  
Element Binding Protein ◽  
Cycle Dependent

Abstract During spermatogenesis, the levels of cAMP in seminiferous tubules undergo stage-dependent cyclical fluctuations. We show that changes in cAMP levels are accompanied by alternative exon splicing of the RNA encoding the cAMP-responsive transcription factor CREB (cAMP response element-binding protein), expressed in both the Sertoli and germ cells. Exons Y and W are expressed exclusively in the testis, and they introduce stop codons into the normal protein coding frame of CREB. The splicing in of W was shown earlier to activate the internal translation of two alternative products of the CREB messenger RNA (mRNA) containing the DNA-binding domain (I-CREBs). The I-CREBs act as potent inhibitors of activator isoforms of CREB. The functions of the alternatively spliced exon Y are unknown. To investigate whether the splicing of exons W and Y is regulated during spermatogenesis, seminiferous tubules, isolated from adult rats, were dissected into segments representing different stages of the spermatogenic cycle and were analyzed by RT-PCR. The analyses of pooled-tubule segments revealed stage-dependent splicing of both exons W and Y in the CREB transcripts. Single tubules were dissected into smaller segments for greater staging accuracy and were analyzed by RT-PCR for CREB mRNAs containing either exons W or Y, as well as for FSH receptor mRNA. This analysis confirmed that a marked, cycle-dependent variation in CREB mRNA levels was occurring. Maximal splicing of exons W and Y occurs independently at different stages of the spermatogenic cycle, stages II-VI and IX, respectively. The distinct spermatogenic cycle-dependent regulation of the splicing of exons W and Y provides further evidence in support of a functional relevance for CREB-W and Y mRNA isoforms in spermatogenesis.

scholarly journals High glucose activates HIF-1-mediated signal transduction in glomerular mesangial cells through a carbohydrate response element binding protein

2010 ◽  
Vol 78 (1) ◽  
pp. 48-59 ◽  
Author(s):  
Tsubasa Isoe ◽  
Yuichi Makino ◽  
Katsutoshi Mizumoto ◽  
Hidemitsu Sakagami ◽  
Yukihiro Fujita ◽  
...  
Keyword(s):  
Signal Transduction ◽  
High Glucose ◽  
Mesangial Cells ◽  
Binding Protein ◽  
Glomerular Mesangial Cells ◽  
Response Element ◽  
Element Binding Protein

The promoter for the gene encoding the catalytic subunit of rat glucose-6-phosphatase contains two distinct glucose-responsive regions

2007 ◽  
Vol 292 (3) ◽  
pp. E788-E801 ◽  
Author(s):  
Kim B. Pedersen ◽  
Pili Zhang ◽  
Chris Doumen ◽  
Marcel Charbonnet ◽  
Danhong Lu ◽  
...  
Keyword(s):  
Promoter Region ◽  
Binding Protein ◽  
Catalytic Subunit ◽  
Mrna Levels ◽  
Dependent Manner ◽  
Glucose Response ◽  
Response Element ◽  
Element Binding Protein ◽  
Insulinoma Cells ◽  
Glucose Responsiveness

Glucose homeostasis requires the proper expression and regulation of the catalytic subunit of glucose-6-phosphatase (G-6- Pase), which hydrolyzes glucose 6-phosphate to glucose in glucose-producing tissues. Glucose induces the expression of G-6- Pase at the transcriptional and posttranscriptional levels by unknown mechanisms. To better understand this metabolic regulation, we mapped the cis-regulatory elements conferring glucose responsiveness to the rat G-6- Pase gene promoter in glucose-responsive cell lines. The full-length (−4078/+64) promoter conferred a moderate glucose response to a reporter construct in HL1C rat hepatoma cells, which was dependent on coexpression of glucokinase. The same construct provided a robust glucose response in 832/13 INS-1 rat insulinoma cells, which are not glucogenic. Glucose also strongly increased endogenous G-6- Pase mRNA levels in 832/13 cells and in rat pancreatic islets, although the induced levels from islets were still markedly lower than in untreated primary hepatocytes. A distal promoter region was glucose responsive in 832/13 cells and contained a carbohydrate response element with two E-boxes separated by five base pairs. Carbohydrate response element-binding protein bound this region in a glucose-dependent manner in situ. A second, proximal promoter region was glucose responsive in both 832/13 and HL1C cells, with a hepatocyte nuclear factor 1 binding site and two cAMP response elements required for glucose responsiveness. Expression of dominant-negative versions of both cAMP response element-binding protein and CAAT/enhancer-binding protein blocked the glucose response of the proximal region in a dose-dependent manner. We conclude that multiple, distinct cis-regulatory promoter elements are involved in the glucose response of the rat G-6- Pase gene.

scholarly journals High glucose induces platelet-derived growth factor-C via carbohydrate response element-binding protein in glomerular mesangial cells

2016 ◽  
Vol 4 (6) ◽  
pp. e12730 ◽  
Author(s):  
Hiroya Kitsunai ◽  
Yuichi Makino ◽  
Hidemitsu Sakagami ◽  
Katsutoshi Mizumoto ◽  
Tsuyoshi Yanagimachi ◽  
...  
Keyword(s):  
Growth Factor ◽  
High Glucose ◽  
Mesangial Cells ◽  
Binding Protein ◽  
Platelet Derived Growth Factor ◽  
Glomerular Mesangial Cells ◽  
Response Element ◽  
Element Binding Protein ◽  
Factor C

Scutellarin Mitigates Cancer-Induced Bone Pain by Suppressing CaMKII/CREB Pathway in Rat Models

2019 ◽  
Vol 17 (3) ◽  
pp. 249-253
Author(s):  
Liu Chenglong ◽  
Liu Haihua ◽  
Zhang Fei ◽  
Zheng Jie ◽  
Wei Fang
Keyword(s):  
Protein Kinase ◽  
Bone Pain ◽  
Binding Protein ◽  
Camp Response Element Binding ◽  
Camp Response Element ◽  
Dependent Protein Kinase ◽  
Response Element ◽  
Protein Kinase Ii ◽  
Element Binding Protein ◽  
Dependent Protein

Cancer-induced bone pain is a severe and complex pain caused by metastases to bone in cancer patients. The aim of this study was to investigate the analgesic effect of scutellarin on cancer-induced bone pain in rat models by intrathecal injection of Walker 256 carcinoma cells. Mechanical allodynia was determined by paw withdrawal threshold in response to mechanical stimulus, and thermal hyperalgesia was indicated by paw withdrawal latency in response to noxious thermal stimulus. The paw withdrawal threshold and paw withdrawal latencies were significantly decreased after inoculation of tumor cells, whereas administration of scutellarin significantly attenuated tumor cell inoculation-induced mechanical and heat hyperalgesia. Tumor cell inoculation-induced tumor growth was also significantly abrogated by scutellarin. Ca2+/calmodulin-dependent protein kinase II is a multifunctional kinase with up-regulated activity in bone pain models. The activation of Ca2+/calmodulin-dependent protein kinase II triggers phosphorylation of cAMP-response element binding protein. Scutellarin significantly reduced the expression of phosphorylated-Ca2+/calmodulin-dependent protein kinase II and phosphorylated-cAMP-response element binding protein in cancer-induced bone pain rats. Collectively, our study demonstrated that scutellarin attenuated tumor cell inoculation-induced bone pain by down-regulating the expression of phosphorylated-Ca2+/calmodulin-dependent protein kinase II and phosphorylated-cAMP-response element binding protein. The suppressive effect of scutellarin on phosphorylated-Ca2+/calmodulin-dependent protein kinase II/phosphorylated-cAMP-response element binding protein activation may serve as a novel therapeutic strategy for CIBP management.

Sign in / Sign up

Export Citation Format

Share Document