scholarly journals Sequence, catalytic properties and expression of chicken glutathione-dependent prostaglandin D2 synthase, a novel class Sigma glutathione S-transferase

1998 ◽  
Vol 333 (2) ◽  
pp. 317-325 ◽  
Author(s):  
Anne M. THOMSON ◽  
David J. MEYER ◽  
John D. HAYES
Keyword(s):  
Amino Acid ◽  
Nucleotide Sequence ◽  
Expressed Sequence Tag ◽  
Sequence Data ◽  
Cdna Clones ◽  
Prostaglandin D2 ◽  
Glutathione S Transferase ◽  
Nucleotide Sequence Data ◽  
Chicken Spleen ◽  
Wide Range

The Expressed Sequence Tag database has been screened for cDNA clones encoding prostaglandin D2 synthases (PGDSs) by using a BLAST search with the N-terminal amino acid sequence of rat GSH-dependent PGDS, a class Sigma glutathione S-transferase (GST). This resulted in the identification of a cDNA from chicken spleen containing an insert of approx. 950 bp that encodes a protein of 199 amino acid residues with a predicted molecular mass of 22732 Da. The deduced primary structure of the chicken protein was not only found to possess 70% sequence identity with rat PGDS but it also demonstrated more than 35% identity with class Sigma GSTs from a range of invertebrates. The open reading frame of the chicken cDNA was expressed in Escherichia coli and the purified protein was found to display high PGDS activity. It also catalysed the conjugation of glutathione with a wide range of aryl halides, organic isothiocyanates and α,β-unsaturated carbonyls, and exhibited glutathione peroxidase activity towards cumene hydroperoxide. Like other GSTs, chicken PGDS was found to be inhibited by non-substrate ligands such as Cibacron Blue, haematin and organotin compounds. Western blotting experiments showed that among the organs studied, the expression of PGDS in the female chicken is highest in liver, kidney and intestine, with only small amounts of the enzyme being found in chicken spleen; in contrast, the rat has highest levels of PGDS in the spleen. Collectively, these results show that the structure and function, but not the expression, of the GSH-requiring PGDS is conserved between chicken and rat. The nucleotide sequence data reported in this paper have been submitted to the EMBL, GenBank, GSDB and DDBJ Nucleotide Sequence Databases under the accession number AJ006405.

Expression patterns of the genes that encode lectin or lectin-related polypeptides in Robinia pseudoacacia

1999 ◽  
Vol 26 (5) ◽  
pp. 495 ◽  
Author(s):  
Kazumasa Yoshida ◽  
Kiyoshi Tazaki
Keyword(s):  
Amino Acid ◽  
Nucleotide Sequence ◽  
Amino Acid Sequence ◽  
Sequence Data ◽  
Expression Patterns ◽  
Robinia Pseudoacacia ◽  
Regulation Of Expression ◽  
Nucleotide Sequence Data ◽  
Reading Frame ◽  
Inner Bark

Three genomic clones (Rplec2, Rplec5 and Rplec6) and a cDNA clone (LECRPA4) that encoded lectin or lectin-related polypeptides were isolated from Robinia pseudoacacia L. A comparison of the nucleotide sequences of Rplec2 and a previously reported cDNA for the subunit indicated that Rplec2 encoded the 29 kDa subunit of the inner-bark lectin RPbAI. Rplec5 encoded a polypeptide whose deduced amino acid sequence was 96.1% identical to that of a subunit of seed lectin. The amino acid sequence deduced from the open reading frame of Rplec6 showed 61.1% identity to that encoded by Rplec5. LECRPA4 was isolated from an inner bark cDNA library and appeared to encode the 26 kDa subunit of inner-bark lectin RPbAII. The expression patterns of the various genes in tissues were examined by the reverse transcriptase-polymerase chain reaction (RT-PCR) with appropriate primers. Rplec2 transcripts were detected in the inner bark and roots. Rplec5 transcripts were detected in the inner bark, seeds and roots. No Rplec6 transcripts were detected in all tissues examined. LECRPA4 transcripts were found in leaves and in the inner bark. The level of expression of Rplec2 in the inner bark appeared to be similar in samples collected in different years and from different trees, whereas levels of expression of Rplec5 and LECRPA4 varied. These results suggest the differential regulation of expression of members of the lectin gene family in tissues of R. pseudoacacia. The nucleotide sequence data reported herein will appear in the DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the accession numbers AB 012632 (Rplec2), AB012633 (Rplec5), AB012634 (Rplec6) and AB012635 (LECRPA4).

Molecular Cloning, Nucleotide Sequence, and Expression in Escherichia coli of a Hemolytic Toxin (Aerolysin) Gene from Aeromonas trota

1998 ◽  
Vol 64 (7) ◽  
pp. 2473-2478 ◽  
Author(s):  
Ashraf A. Khan ◽  
Eungbin Kim ◽  
Carl E. Cerniglia
Keyword(s):  
Escherichia Coli ◽  
Amino Acid ◽  
Nucleotide Sequence ◽  
Amino Acid Sequence ◽  
Sequence Data ◽  
Kanamycin Resistance ◽  
Aeromonas Salmonicida ◽  
Amino Acid Sequences ◽  
Nucleotide Sequence Data ◽  
Hemolytic Toxin

ABSTRACT Aeromonas trota AK2, which was derived from ATCC 49659 and produces the extracellular pore-forming hemolytic toxin aerolysin, was mutagenized with the transposon mini-Tn5Km1 to generate a hemolysin-deficient mutant, designated strain AK253. Southern blotting data indicated that an 8.7-kb NotI fragment of the genomic DNA of strain AK253 contained the kanamycin resistance gene of mini-Tn5Km1. The 8.7-kb NotI DNA fragment was cloned into the vector pGEM5Zf(−) by selecting for kanamycin resistance, and the resultant clone, pAK71, showed aerolysin activity in Escherichia coli JM109. The nucleotide sequence of the aerA gene, located on the 1.8-kbApaI-EcoRI fragment, was determined to consist of 1,479 bp and to have an ATG initiation codon and a TAA termination codon. An in vitro coupled transcription-translation analysis of the 1.8-kb region suggested that the aerA gene codes for a 54-kDa protein, in agreement with nucleotide sequence data. The deduced amino acid sequence of the aerA gene product ofA. trota exhibited 99% homology with the amino acid sequence of the aerA product of Aeromonas sobria AB3 and 57% homology with the amino acid sequences of the products of the aerA genes of Aeromonas salmonicida 17-2 and A. sobria 33.

scholarly journals First Report of Broad bean wilt virus 1 in Spain

Plant Disease ◽  
2002 ◽  
Vol 86 (6) ◽  
pp. 698-698 ◽  
Author(s):  
L. Rubio ◽  
M. Luis-Arteaga ◽  
M. Cambra ◽  
J. Serra ◽  
P. Moreno ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Broad Bean ◽  
Sequence Data ◽  
Coat Proteins ◽  
Nucleotide Sequence Data ◽  
First Report ◽  
Virus Serotype ◽  
Wide Range ◽  
Wilt Virus ◽  
Broad Bean Wilt Virus

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain. References: (1) M. G. Bellardi et al. Plant Dis. 81:959, 1997. (2) K. M. Makkouk et al. Neth. J. Plant Pathol. 96:291, 1990.

scholarly journals Genetic defect in N-acetylglucosaminyltransferase I gene of a ricin-resistant baby hamster kidney mutant

1998 ◽  
Vol 336 (3) ◽  
pp. 593-598 ◽  
Author(s):  
Andrew S. OPAT ◽  
Hamsa PUTHALAKATH ◽  
Jo BURKE ◽  
Paul A. GLEESON
Keyword(s):  
Nucleotide Sequence ◽  
Sequence Data ◽  
Stop Codon ◽  
Genetic Defect ◽  
Premature Stop Codon ◽  
Cdna Clones ◽  
Baby Hamster Kidney ◽  
Wild Type ◽  
Nucleotide Sequence Data ◽  
Critical Residue

The analysis of mutations associated with glycosylation-defective cell lines has the potential for identifying critical residues associated with the activities of enzymes involved in the biosynthesis of glycoconjugates. A ricin-resistant (RicR) baby hamster kidney (BHK) cell mutant, clone RicR14, has a deficiency in N-acetylglucosaminyltransferase I (GlcNAc-TI) activity and as a consequence is unable to synthesize complex and hybrid N-glycans. Here we show that RicR14 cells transfected with wild-type GlcNAc-TI regained the ability to synthesize complex N-glycans, demonstrating that the glycosylation defect of RicR14 cells is due solely to the lack of GlcNAc-TI activity. With the use of specific antibodies to GlcNAc-TI, RicR14 cells were shown to synthesize an inactive GlcNAc-TI protein that is correctly localized to the Golgi apparatus. We have cloned and sequenced the open reading frame of GlcNAc-TI from parental BHK and RicR14 cells. A comparison of several RicR14 cDNA clones with the parental BHK GlcNAc-TI sequence indicated the presence of two different RicR14 cDNA species. One contained a premature stop codon at position +81, whereas the second contained a point mutation in the catalytic domain of GlcNAc-TI resulting in the amino acid substitution Gly320 → Asp. The introduction of a Gly320 → Asp mutation into wild-type rabbit GlcNAc-TI resulted in a complete loss of activity; the GlcNAc-TI mutant was correctly localized to the Golgi, indicating that the inactive GlcNAc-TI protein was transport-competent. Gly320 is conserved in GlcNAc-TI from all species so far examined. Overall these results demonstrate that Gly320 is a critical residue for GlcNAc-TI activity. The nucleotide sequence data reported will appear in DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the accession numbers AF087456 and AF087457.

Sign in / Sign up

Export Citation Format

Share Document