scholarly journals Ligand-dependent enhancement of human antithrombin gene expression by retinoid X receptor α and thyroid hormone receptor β

1996 ◽  
Vol 318 (1) ◽  
pp. 263-270 ◽  
Author(s):  
René W. L. M. NIESSEN ◽  
Farhad REZAEE ◽  
Pieter H. REITSMA ◽  
Marjolein PETERS ◽  
Jan J. M. de VIJLDER ◽  
...  

We studied potential modulators of antithrombin gene expression. A putative hormone response element (HRE) was identified by sequence similarity analysis of the antithrombin promoter, situated between nucleotides -92 and -54 relative to the transcription start site. This HRE contains three hexanucleotide motifs with an AGGTCA consensus, which are potential targets of members of the steroid/thyroid superfamily of nuclear receptors. Stimulation of the hepatoma cell line HepG2 with the receptor ligands l-3,5,3´-tri-iodothyronine, all-trans retinoic acid, or their combination, increased production of antithrombin into the culture medium by 1.3-, 1.6-, and 2.0-fold, respectively. In contrast, the receptor ligand 1,25-dihydroxycholecalciferol [1,25-(OH)2VitD3] did not influence antithrombin production. Analysis of promoter chloramphenicol acetyltransferase (CAT) constructs, showed that the first 86 bp of the antithrombin promoter region are sufficient for basal transcription. The DNA length polymorphism of 32 bp or 108 bp, located upstream of position -276, did not influence antithrombin promoter activity. The antithrombin promoter activity dropped to background values when deleting the region -97/-49 of promoter fragment -453/+57. Transactivation of the antithrombin promoter by retinoid X receptor α (RXRα) (5–7-fold) or thyroid hormone receptor β (TRβ) (4–5-fold) was only observed when at least -167/+57 bp of the promoter region is present in CAT constructs, and when the appropriate ligand of the nuclear receptor was added. This transactivation was not observed upon deletion of the antithrombin promoter region -97/-49. With three copies of the antithrombin promoter fragment -109/-42 in front of the thymidine kinase minimal promoter, transactivation was only obtained with RXRα, and not with TRβ. In conclusion, these results indicate that the ligand-dependent enhancement of antithrombin gene expression is regulated by RXRα as well as by TRβ. Transactivation of antithrombin gene expression by RXRα and TRβ appears to be dependent upon the presence of promoter region up to nucleotide -167. The HRE segment (-109/-42) only confers RXRα responsiveness to a heterologous promoter. Further study is needed to unravel the exact nature of this HRE and its 5´-flanking sequences.

Endocrinology ◽  
2006 ◽  
Vol 147 (9) ◽  
pp. 4292-4302 ◽  
Author(s):  
Koshi Hashimoto ◽  
Masanobu Yamada ◽  
Shunichi Matsumoto ◽  
Tsuyoshi Monden ◽  
Teturou Satoh ◽  
...  

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.


Endocrinology ◽  
2008 ◽  
Vol 149 (5) ◽  
pp. 2241-2250 ◽  
Author(s):  
Teresa Otto ◽  
Joachim Fandrey

Thyroid hormones are important regulators of differentiation, growth, metabolism, and physiological function of virtually all tissues. Active thyroid hormone T3 affects expression of genes that encode for angiogenic proteins like adrenomedullin or vascular endothelial growth factor and erythropoietin, as well as for glucose transporters and phospho fructokinase that determine glucose use. Interestingly, those target genes are also hypoxia inducible and under the control of the oxygen-dependent transcription factor hypoxia-inducible factor (HIF)-1). We and others have reported that T3 stimulates HIF-1 activation, which intimately links T3 and HIF-1 induced gene expression. Here, we studied intracellular pathways that mediate HIF-1α regulation by T3. We found that T3-dependent HIF-1 activation is not limited to hepatoma cells but is also observed in primary human hepatocytes, kidney and lung carcinoma cells. T3 increased the HIF-1α subunit mRNA and protein within a few hours through activation of the thyroid hormone receptor β retinoid X receptor α heterodimer because knockdown of each of the partners abrogated the stimulation by T3. However, T3 had no direct effect on transcription of HIF-1α, but activation of the thyroid hormone receptor β/retinoid X receptor α heterodimer by T3 stimulated expression of the hepatic leukemia factor, which increases HIF-1α gene expression.


1997 ◽  
Vol 272 (20) ◽  
pp. 13060-13065 ◽  
Author(s):  
Trevor N. Collingwood ◽  
Alison Butler ◽  
Yukiko Tone ◽  
Rory J. Clifton-Bligh ◽  
Malcolm G. Parker ◽  
...  

2011 ◽  
Vol 96 (6) ◽  
pp. E948-E952 ◽  
Author(s):  
Tetsuya Tagami ◽  
Takeshi Usui ◽  
Akira Shimatsu ◽  
Mutsuo Beniko ◽  
Hiroyuki Yamamoto ◽  
...  

Context: Patients with TSH-secreting pituitary adenomas (TSHoma) show inappropriate secretion of TSH; serum TSH levels are not suppressed despite high serum free thyroid hormone levels. The mechanism of a defect in negative regulation of TSH in a TSHoma is still unclear. Objective: Recently, we cloned a novel thyroid hormone receptor β isoform (TRβ4) from a human pituitary library. To elucidate the clinical significance of TRβ4, we investigated the expression of this isoform in TSHoma. Methods: RT-PCR was performed to detect TRβ isoforms such as TRβ1, TRβ2, and TRβ4 using RNA obtained from surgically resected TSHoma. The effects of TRβ4 on the TSH gene expression were examined in the transient gene expression experiments. Results: Quantitative analysis using a real-time PCR revealed that relative expression of TRβ4 to TRβ1+2 was higher in three TSHoma than in a prolactinoma or a nonfunctioning pituitary adenoma. TRβ4 construct did not mediate T3-dependent gene regulation but inhibited the negative regulation of TSHα mediated by TRβ1 or TRβ2. Conclusions: Aberrant expression of TRβ4 may partly contribute to the inappropriate secretion of TSH in a TSHoma.


Endocrinology ◽  
2018 ◽  
Vol 159 (6) ◽  
pp. 2484-2494 ◽  
Author(s):  
Noelle E Gillis ◽  
Thomas H Taber ◽  
Eric L Bolf ◽  
Caitlin M Beaudet ◽  
Jennifer A Tomczak ◽  
...  

Abstract Thyroid hormone receptor β (TRβ) suppresses tumor growth through regulation of gene expression, yet the associated TRβ-mediated changes in chromatin assembly are not known. The chromatin ATPase brahma-related gene 1 (BRG1; SMARCA4), a key component of chromatin-remodeling complexes, is altered in many cancers, but its role in thyroid tumorigenesis and TRβ-mediated gene expression is unknown. We previously identified the oncogene runt-related transcription factor 2 (RUNX2) as a repressive target of TRβ. Here, we report differential expression of BRG1 in nonmalignant and malignant thyroid cells concordant with TRβ. BRG1 and TRβ have similar nuclear distribution patterns and significant colocalization. BRG1 interacts with TRβ, and together, they are part of the regulatory complex at the RUNX2 promoter. Loss of BRG1 increases RUNX2 levels, whereas reintroduction of TRβ and BRG1 synergistically decreases RUNX2 expression. RUNX2 promoter accessibility corresponded to RUNX2 expression levels. Inhibition of BRG1 activity increased accessibility of the RUNX2 promoter and corresponding expression. Our results reveal a mechanism of TRβ repression of oncogenic gene expression: TRβ recruitment of BRG1 induces chromatin compaction and diminishes RUNX2 expression. Therefore, BRG1-mediated chromatin remodeling may be obligatory for TRβ transcriptional repression and tumor suppressor function in thyroid tumorigenesis.


Glia ◽  
1993 ◽  
Vol 9 (2) ◽  
pp. 105-112 ◽  
Author(s):  
Jean-Marc Lebel ◽  
Sylvie L'Hérault ◽  
Jean H. Dussault ◽  
Jack Puymirat

1997 ◽  
Vol 17 (12) ◽  
pp. 7195-7207 ◽  
Author(s):  
J S Qi ◽  
V Desai-Yajnik ◽  
Y Yuan ◽  
H H Samuels

Thyroid hormone receptor (T3R) is a member of the steroid hormone receptor gene family of nuclear hormone receptors. In most cells T3R activates gene expression only in the presence of its ligand, L-triiodothyronine (T3). However, in certain cell types (e.g., GH4C1 cells) expression of T3R leads to hormone-independent constitutive activation. This activation by unliganded T3R occurs with a variety of gene promoters and appears to be independent of the binding of T3R to specific thyroid hormone response elements (TREs). Previous studies indicate that this constitutive activation results from the titration of an inhibitor of transcription. Since the tumor suppresser p53 is capable of repressing a wide variety of gene promoters, we considered the possibility that the inhibitor is p53. Evidence to support this comes from studies indicating that expression of p53 blocks T3R-mediated constitutive activation in GH4C1 cells. In contrast with hormone-independent activation by T3R, p53 had little or no effect on T3-dependent stimulation which requires TREs. In addition, p53 mutants which oligomerize with wild-type p53 and interfere with its function also increase promoter activity. This enhancement is of similar magnitude to but is not additive with the stimulation mediated by unliganded T3R, suggesting that they target the same factor. Since p53 mutants are known to target wild-type p53 in the cell, this suggests that T3R also interacts with p53 in vivo and that endogenous levels of p53 act to suppress promoter activity. Evidence supporting both functional and physical interactions of T3R and p53 in the cell is presented. The DNA binding domain (DBD) of T3R is important in mediating constitutive activation, and the receptor DBD appears to functionally interact with the N terminus of p53 in the cell. In vitro binding studies indicate that the T3R DBD is important for interaction of T3R with p53 and that this interaction is reduced by T3. These findings are consistent with the in vivo studies indicating that p53 blocks constitutive activation but not ligand-dependent stimulation. These studies provide insight into mechanisms by which unliganded nuclear hormone receptors can modulate gene expression and may provide an explanation for the mechanism of action of the v-erbA oncoprotein, a retroviral homolog of chicken T3R alpha.


Sign in / Sign up

Export Citation Format

Share Document