scholarly journals SARP, a new alternatively spliced protein phosphatase 1 and DNA interacting protein

2007 ◽  
Vol 402 (1) ◽  
pp. 187-196 ◽  
Author(s):  
Gareth J. Browne ◽  
Margarida Fardilha ◽  
Senga K. Oxenham ◽  
Wenjuan Wu ◽  
Nicholas R. Helps ◽  
...  
Keyword(s):  
Protein Phosphatase ◽  
Mammalian Cells ◽  
Leucine Zipper ◽  
Transforming Growth Factor ◽  
Binding Protein ◽  
Transforming Growth Factor Β ◽  
Ankyrin Repeat ◽  
Protein Phosphatase 1 ◽  
Binding Motif ◽  
Alternative Mrna Splicing

PP1 (protein phosphatase 1) is a ubiquitously expressed serine/threonine-specific protein phosphatase whose activity towards different substrates appears to be mediated via binding to specific proteins that play critical regulatory and targeting roles. In the present paper we report the cloning and characterization of a new protein, termed SARP (several ankyrin repeat protein), which is shown to interact with all isoforms of PP1 by a variety of techniques. A region encompassing a consensus PP1-binding motif in SARP (K354VHF357) modulates endogenous SARP–PP1 activity in mammalian cells. This SARP–PP1 interaction motif lies partially within the first ankyrin repeat in contrast with other proteins [53BP2 (p53 binding protein 2), MYPT1/M110/MBS (myosin binding protein of PP1) and TIMAP (transforming growth factor β inhibited, membrane-associated protein)], where a PP1-binding motif precedes the ankyrin repeats. Alternative mRNA splicing produces several isoforms of SARP from a single human gene at locus 11q14. SARP1 and/or SARP2 (92–95 kDa) are ubiquitously expressed in all tissues with high levels in testis and sperm, where they are shown to interact with both PP1γ1 and PP1γ2. SARP3 (65 kDa) is most abundant in brain where SARP isoforms interact with both PP1α and PP1γ1. SARP is highly abundant in the nucleus of mammalian cells, consistent with the putative nuclear localization signal at the N-terminus. The presence of a leucine zipper near the C-terminus of SARP1 and SARP2, and the binding of mammalian DNA to SARP2, suggests that SARP1 and SARP2 may be transcription factors or DNA-associated proteins that modulate gene expression.

scholarly journals TAK1-binding protein 1 is a pseudophosphatase

2006 ◽  
Vol 399 (3) ◽  
pp. 427-434 ◽  
Author(s):  
Sarah H. Conner ◽  
Gursant Kular ◽  
Mark Peggie ◽  
Sharon Shepherd ◽  
Alexander W. Schüttelkopf ◽  
...  
Keyword(s):  
Metal Binding ◽  
Protein Phosphatase ◽  
Transforming Growth Factor ◽  
Binding Protein ◽  
Structural Similarity ◽  
Transforming Growth Factor Β ◽  
Titration Calorimetry ◽  
Regulatory Subunits ◽  
Nitrophenyl Phosphate ◽  
Dual Metal

TAB1 [TAK1 (transforming growth factor-β-activated kinase 1)-binding protein 1] is one of the regulatory subunits of TAK1, a protein kinase that lies at the head of three pro-inflammatory kinase cascades. In the current study we report the crystal structure of the N-terminal domain of TAB1. Surprisingly, TAB1 possesses a fold closely related to that of the PPM (Mg2+- or Mn2+-dependent protein phosphatase) family as demonstrated by the close structural similarity with protein phosphatase 2Cα. However, we were unable to detect any phosphatase activity for TAB1 using a phosphopeptide or p-nitrophenyl phosphate as substrate. Although the overall protein phosphatase 2Cα fold is conserved in TAB1, detailed structural analyses and mutagenesis studies show that several key residues required for dual metal-binding and catalysis are not present in TAB1, although binding of a single metal is supported by soaking experiments with manganese and isothermal titration calorimetry. Thus, it appears that TAB1 is a ‘pseudophosphatase’, possibly binding to and regulating accessibility of phosphorylated residues on substrates downstream of TAK1 or on the TAK1 complex itself.

Versican G1 and G3 domains are upregulated and latent transforming growth factor-β binding protein-4 is downregulated in breast cancer stroma

Breast Cancer ◽  
2011 ◽  
Vol 19 (1) ◽  
pp. 46-53 ◽  
Author(s):  
Yuko Takahashi ◽  
Hiroko Kuwabara ◽  
Masahiko Yoneda ◽  
Zenzo Isogai ◽  
Nobuhiko Tanigawa ◽  
...  
Keyword(s):  
Breast Cancer ◽  
Growth Factor ◽  
Transforming Growth Factor ◽  
Binding Protein ◽  
Transforming Growth Factor Β ◽  
Cancer Stroma

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Latent transforming growth factor-β binding protein-1 LTBP1

1998 ◽  
pp. 178-180
Author(s):  
Shirley Ayad ◽  
Ray Boot-Handford ◽  
Martin J. Humphries ◽  
Karl E. Kadler ◽  
Adrian Shuttleworth
Keyword(s):  
Growth Factor ◽  
Transforming Growth Factor ◽  
Binding Protein ◽  
Transforming Growth Factor Β
Sign in / Sign up

Export Citation Format

Share Document