scholarly journals Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins

2005 ◽  
Vol 388 (1) ◽  
pp. 291-297 ◽  
Author(s):  
Christine M. MISQUITTA ◽  
Paromita GHOSH ◽  
James MWANJEWE ◽  
Ashok K. GROVER
Keyword(s):  
Electrophoretic Mobility ◽  
Nuclear Protein ◽  
Left Ventricular ◽  
Nuclear Proteins ◽  
Proximal Fragment ◽  
Mobility Shift ◽  
Cis Acting ◽  
Nuclear Extracts ◽  
Rna Fragments

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3′-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3′-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3′-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5′)ppp(5′)Gm] and polyadenylated (A40) RNA fragments from the 3′-end region (3444–4472) of SERCA2b. The proximal fragment 2B1 (3444–3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521–3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

scholarly journals An investigation of acid-soluble nuclear proteins of human leucocytes in relation to fraction RP2-L, a component of neoplastic cells

1968 ◽  
Vol 107 (6) ◽  
pp. 799-806 ◽  
Author(s):  
A J MacGillivray ◽  
J. P. P. V. Monjardino
Keyword(s):  
Nuclear Protein ◽  
Tumour Cells ◽  
Nuclear Proteins ◽  
Cell Nuclei ◽  
Histone Protein ◽  
Chromosomal Origin ◽  
Nuclear Extracts ◽  
Mixed Samples ◽  
Specific Nuclear Protein

1. The claim that tumour cells contain a specific nuclear protein was investigated. The presence of this component was confirmed in Walker tumour cells by the chromatography on CM-cellulose of nuclear proteins labelled with [14C]lysine. This protein was studied further in a number of human leucocyte cells. 2. The labelling of leucocyte nuclear proteins with [14C]lysine was attempted during incubation and culture in vitro. Incorporation of the label into acid-soluble nuclear proteins was highest in normal lymphocytes cultured with phytohaemagglutinin, followed by chronic-myeloid-leukaemic leucocytes and mixed samples of normal leucocytes incubated in plasma. Little incorporation was seen in similar extracts of chronic-lymphatic or normal leucocytes. 3. Lymphocytes were the only cells that gave nuclear extracts with amino acid analysis similar to that of unfractionated histones. 4. Little of the [14C]lysine in nuclear extracts of incubated leucocytes proved to be of chromosomal origin. No evidence was found of an RP2-L component in the highly labelled nuclear extracts of phytohaemagglutinin-treated lymphocytes until after 6 days of culture with [14C]lysine. This component was soluble in saline. 5. Evidence is presented that fraction RP2-L is a non-histone protein constituent of cell nuclei whose labelling with [14C]lysine may be dependent on the metabolic state of the cell. Thus this component is not specific to the neoplastic state.

scholarly journals Identification of the DNA binding element of the human ZNF300 protein

2008 ◽  
Vol 13 (3) ◽  
Author(s):  
Hongling Qiu ◽  
Lu Xue ◽  
Li Gao ◽  
Huanjie Shao ◽  
Di Wang ◽  
...  
Keyword(s):  
Dna Binding ◽  
Binding Site ◽  
Electrophoretic Mobility ◽  
Nuclear Protein ◽  
Transcriptional Regulator ◽  
Mobility Shift ◽  
Dna Binding Site ◽  
Specific Manner ◽  
Electrophoretic Mobility Shift Assays

AbstractThe human ZNF300 gene is a member of the KRAB/C2H2 zinc finger gene family, the members of which are known to be involved in various developmental and pathological processes. Here, we show that the ZNF300 gene encodes a 68-kDa nuclear protein that binds DNA in a sequence-specific manner. The ZNF300 DNA binding site, C(t/a)GGGGG(c/g)G, was defined via a random oligonucleotide selection assay, and the DNA binding site was further confirmed by electrophoretic mobility shift assays. A potential ZNF300 binding site was found in the promoter region of the human IL-2Rβ gene. The results of electrophoretic mobility shift assays indicated that ZNF300 bound to the ZNF300 binding site in the IL-2Rβ promoter in vitro. Transient co-transfection assays showed that ZNF300 could activate the IL-2Rβ promoter, and that the activation was abrogated by the mutation of residues in the ZNF300 binding site. Identifying the DNA binding site and characterizing the transcriptional regulation property of ZNF300 would provide critical insights into its potential as a transcriptional regulator.

scholarly journals Analysis of nuclear glucocorticoid receptor-DNA interaction in aged rat liver

2005 ◽  
Vol 70 (5) ◽  
pp. 705-712 ◽  
Author(s):  
Miroslava Vujcic ◽  
Natasa Terzic ◽  
Aleksandra Ristic-Fira ◽  
Dusan Kanazir ◽  
Sabera Ruzdijic
Keyword(s):  
Dna Interaction ◽  
Binding Activity ◽  
Regulatory Proteins ◽  
Nuclear Proteins ◽  
Middle Aged ◽  
Mobility Shift ◽  
Nuclear Extracts ◽  
Supershift Assay ◽  
Mobility Shift Assay ◽  
Oligonucleotide Analogues

Abstract: In order to contribute to the understanding of mechanisms by which regulatory proteins recognize genetic information stored in DNA, analyses of their interaction with specific nucleotides are usually performed. In this study, the electrophoretic mobility shift assay (EMSA) was applied to analyze the interaction of nuclear proteins from the liver of rats of different age i.e., young (3-month-old), middle- aged (12-month-old) and aged (24-month-old), with radioactively labelled synthetic oligonucleotide analogues, corresponding to GRE. The levels of GRE binding activity were assessed by quantitative densitometric scanning of the autoradiograms. The results showed statistically significant decreasing values of up to 78% and 49% in middle aged and old animals, respectively, compared to young animals (p < 0.05). The specificity of the nuclear proteins-GRE interaction was demonstrated by competition experiments with unlabelled GRE. In a supershift assay, using the antibody BuGR2, it was shown that the GR proteins present in nuclear extracts have a high affinity for the GRE probe. The stabilities of the protein-DNA complexes were analysed and it was concluded that they changed during ageing. .

Mutation of the c-fos gene dyad symmetry element inhibits serum inducibility of transcription in vivo and the nuclear regulatory factor binding in vitro

1987 ◽  
Vol 7 (3) ◽  
pp. 1217-1225
Author(s):  
M E Greenberg ◽  
Z Siegfried ◽  
E B Ziff
Keyword(s):  
Growth Factor ◽  
Nuclear Protein ◽  
Symmetry Element ◽  
Regulatory Sequence ◽  
In Vitro Mutagenesis ◽  
Regulatory Factor ◽  
Mobility Shift ◽  
Sequence Element ◽  
Dyad Symmetry

In vitro mutagenesis of a 61-base-pair DNA sequence element that is necessary for induction of the c-fos proto-oncogene by growth factors revealed that a small region of dyad symmetry within the sequence element is critical for c-fos transcriptional activation. The same c-fos dyad symmetry element was found to bind a nuclear protein in vitro, causing a specific mobility shift of this c-fos regulatory sequence. An analysis of insertion and deletion mutants established a strict correlation between the ability of the dyad symmetry element to promote serum activation of c-fos transcription and in vitro nuclear protein binding. These experiments suggest that the DNA mobility shift assay detects a nuclear protein that mediates growth factor stimulation of c-fos expression. In vitro competition experiments indicate that the c-fos regulatory factor also binds to sequences within another growth factor-inducible gene, the beta-actin gene.

scholarly journals An AC-Rich Bean Element Serves as an Ethylene-Responsive Element in Arabidopsis

Plants ◽  
2020 ◽  
Vol 9 (8) ◽  
pp. 1033
Author(s):  
Chunying Wang ◽  
Tingting Lin ◽  
Mengqi Wang ◽  
Xiaoting Qi
Keyword(s):  
Nuclear Proteins ◽  
Ethylene Response Factor ◽  
Response Factor ◽  
Cis Acting ◽  
Gcc Box ◽  
Ethylene Response ◽  
Significant Difference ◽  
Responsive Element ◽  
Transcription Factor 1

Ethylene-responsive elements (EREs), such as the GCC box, are critical for ethylene-regulated transcription in plants. Our previous work identified a 19-bp AC-rich element (ACE) in the promoter of bean (Phaseolus vulgaris) metal response element-binding transcription factor 1 (PvMTF-1). Ethylene response factor 15 (PvERF15) directly binds ACE to enhance PvMTF-1 expression. As a novel ERF-binding element, ACE exhibits a significant difference from the GCC box. Here, we demonstrated that ACE serves as an ERE in Arabidopsis. It conferred the minimal promoter to respond to the ethylene stress and inhibition of ethylene. Moreover, the cis-acting element ACE could specifically bind the nuclear proteins in vitro. We further revealed that the first 9-bp sequence of ACE (ACEcore) is importantly required by the binding of nuclear proteins. In addition, PvERF15 and PvMTF-1 were strongly induced by ethylene in bean seedlings. Since PvERF15 activates PvMTF-1 via ACE, ACE is involved in ethylene-induced PvMTF-1 expression. Taken together, our findings provide genetic and biochemical evidence for a new ERE.

scholarly journals Transcriptional control of the factor IX gene: analysis of five cis- acting elements and the deleterious effects of naturally occurring hemophilia B Leyden mutations

Blood ◽  
1994 ◽  
Vol 84 (9) ◽  
pp. 2992-3000 ◽  
Author(s):  
DJ Picketts ◽  
CR Mueller ◽  
D Lillicrap
Keyword(s):  
Dna Binding ◽  
Protein Binding ◽  
Transcriptional Activation ◽  
In Vitro Transcription ◽  
Factor Ix ◽  
Hemophilia B ◽  
Transcription Assay ◽  
Cis Acting ◽  
Nuclear Extracts

Abstract Hemophilia B Leyden is a rare form of inherited factor IX deficiency in which patients experience spontaneous postpubertal recovery of factor IX levels. The mutations resulting in this disorder are localized in a 40-nucleotide region encompassing the major transcriptional start site for factor IX. Here we report the further characterization of five cis- acting elements in the factor IX promoter and the effects on protein binding and transcriptional activation of five Leyden mutations (at nucleotides +13, -5, -6, -20, and -26) that occur within the proximal three elements (sites 1 through 3). Bandshift studies using nuclear extracts from four different rat tissues have shown that at least some of the proteins binding to each of the five sites are ubiquitous in nature. The pattern of DNA binding at site 1 suggests that this element plays an important role in mediating the liver-specific expression of factor IX. Additional studies with liver nuclear extracts obtained at several different points in development have shown an increase in DNA binding at sites 1, 4, and 5 between 1 day and 1 week. Using DNase I footprint analysis and competition bandshift studies, we have shown that the binding of nuclear proteins to each of the mutant sites is disrupted to a variable extent. There appears to be some, although reduced, protein binding to all of the mutant oligonucleotides apart from the -26 mutant. In vitro transcription assays have shown that each of the mutations reduces the global proximal promoter activity by approximately 40%. Two double mutant promoters did not show any additional downregulation in the in vitro transcription assay. In experiments designed to assess the relative transcriptional activity mediated from each of the five sites independently, we have tested artificial homopolymer promoters of each site in the in vitro transcription assay. These studies show that sites 4 and 5 are the strongest activators and that transactivation from site 5 is further enhanced by the albumin D site-binding protein. In summary, these investigations show deleterious effects of each of the Leyden mutations tested on the binding of trans-acting factors and also show disruption of transcriptional activation in a functional in vitro transcription assay. Our results also show that cis-acting elements 4 and 5 are the principal activators of this locus.

scholarly journals Activity of the carbamyl phosphate synthetase I promoter in liver nuclear extracts is dependent on a cis-acting C/EBP recognition element.

1989 ◽  
Vol 9 (7) ◽  
pp. 2928-2933 ◽  
Author(s):  
B W Howell ◽  
M Lagacé ◽  
G C Shore
Keyword(s):  
In Vitro Transcription ◽  
Proximal Promoter ◽  
Upstream Region ◽  
Carbamyl Phosphate ◽  
Cis Acting ◽  
Carbamyl Phosphate Synthetase ◽  
Recognition Element ◽  
Cis Element ◽  
Nuclear Extracts

We have identified an essential cis element in the proximal promoter region of the rat carbamyl phosphate synthetase I (CPSI) gene that is requisite for promoter activity in liver nuclear extracts. Excess synthetic oligonucleotides specifying this region abolished promoter-dependent in vitro transcription. We show that C/EBP, a nuclear factor enriched in liver but found as well in other tissues, such as gut, fat, and lung, interacts with an inverted repeat, GTTGCAAC, at the core of the essential cis element. In brain, a tissue that did not express CPSI or contain significant levels of C/EBP, a different factor was capable of binding at or near the C/EBP recognition element. Activity of the CPSI promoter in liver nuclear extracts was also dependent on sequences 5' to the C/EBP motif; presumably, factors binding to elements within this upstream region are instrumental in restricting CPSI gene expression to liver and intestinal mucosa.

scholarly journals Regulated expression of nuclear protein(s) in myogenic cells that binds to a conserved 3' untranslated region in pro alpha 1 (I) collagen cDNA.

1989 ◽  
Vol 9 (7) ◽  
pp. 2828-2836 ◽  
Author(s):  
T Herget ◽  
M Burba ◽  
M Schmoll ◽  
K Zimmermann ◽  
A Starzinski-Powitz
Keyword(s):  
Untranslated Region ◽  
Nuclear Protein ◽  
Protein S ◽  
Target Sequence ◽  
Conserved Sequence ◽  
L6 Myotubes ◽  
Double Stranded Dna ◽  
Nuclear Extracts ◽  
Collagen Genes

We describe the identification and DNA-binding properties of nuclear proteins from rat L6 myoblasts which recognize an interspecies conserved 3' untranslated segment of pro alpha 1 (I) collagen cDNA. Levels of the two pro alpha 1 (I) collagen RNAs, present in L6 myoblasts, decreased drastically between 54 and 75 h after induction of myotube formation in serum-free medium. Both mRNAs contained a conserved sequence segment of 135 nucleotides (termed tame sequence) in the 3' untranslated region that had 96% homology to the human and murine pro alpha 1 (I) collagen genes. The cDNA of this tame sequence was specifically recognized by nuclear protein(s) from L6 myoblasts, as judged by gel retardation assays and DNase I footprints. The tame-binding protein(s) was able to recognize its target sequence on double-stranded DNA but bound also to the appropriate single-stranded oligonucleotide. Protein that bound to the tame sequence was undetectable in nuclear extracts of L6 myotubes that did not accumulate the two collagen mRNAs. Therefore, the activity of this nuclear protein seems to be linked to accumulation of the sequences that it recognizes in vitro. The collagen RNAs and the nuclear tame-binding proteins reappeared after a change of medium, which further suggests that the RNAs and the protein(s) are coordinately regulated.

3,5-Diiodo-L-thyronine (T2) has selective thyromimetic effects in vivo and in vitro

1997 ◽  
Vol 19 (2) ◽  
pp. 137-147 ◽  
Author(s):  
SG Ball ◽  
J Sokolov ◽  
WW Chin
Keyword(s):  
Gh3 Cells ◽  
Mrna Levels ◽  
Thyroid Status ◽  
Hormone Activity ◽  
Mobility Shift ◽  
Nuclear Extracts ◽  
Electrophoretic Mobility Shift Assays ◽  
Gh3 Cell

Recent data have suggested that the iodothyronine, 3,5-diiodo-l-thyronine (T2), has selective thyromimetic activity. In vivo, T2 has been shown to suppress TSH levels at doses that do not produce significant peripheral manifestations of thyroid hormone activity. Furthermore, T2 has been shown to produce smaller increments in peripheral indices of thyroid status than does T3, when doses resulting in equivalent suppression of circulating TSH are compared. We have assessed the selective thyromimetic activity of T2 in vivo and in vitro, and performed in vitro studies to assess the potential molecular basis for these selective properties. T2 was 100-fold less potent than T3 in stimulating GH mRNA levels in GH3 cells. In contrast, the iodothyronines were almost equivalent in their ability to downregulate TRbeta2 mRNA levels in this cell line. Both 3,3'-diiodo-L-thyronine and thyronine exhibited no significant thyromimetic effects on either process. In vivo, doses of T2 and T3 that were equivalent in their induction of hepatic malic enzyme (ME) mRNA did not produce equivalent suppression of circulating TSH, with T2 being only 27% as effective as T3. T2 was up to 500-fold less potent than T3 in displacing [125I]-T3 from in vitro translated specific nuclear receptors (TRs) and GH3 cell nuclear extracts. Electrophoretic mobility shift assays, assessing the ability of T2 to produce dissociation of TRbeta1 homodimers from inverted palindrome T3 response elements, indicated that T2 was also 1000-fold less potent than T3 in this respect. These data confirm that T2 has significant thyromimetic activity, and that this activity is selective both in vivo and in vitro. However, there are no data to support a selective central effect, T2 being relatively more potent in stimulating hepatic ME mRNA than in suppression of TSH in vivo. The basis for this differential thyromimetic activity is not selective affinity of the different TR isoforms for T2, or divergent properties of T2 in competitive binding and functional assays in vitro.

Sign in / Sign up

Export Citation Format

Share Document