Characterization of the heavy metal binding properties of periplasmic metal uptake protein CLas-ZnuA2

Metallomics ◽  
2020 ◽  
Vol 12 (2) ◽  
pp. 280-289 ◽  
Author(s):  
Pranav Kumar ◽  
Vikram Dalal ◽  
Nidhi Sharma ◽  
Sunil Kokane ◽  
Dilip Kumar Ghosh ◽  
...  
Keyword(s):  
Metal Binding ◽  
Metal Uptake ◽  
Citrus Greening ◽  
Negative Bacterium ◽  
Binding Properties ◽  
Citrus Greening Disease ◽  
Heavy Metal Binding ◽  
Liberibacter Asiaticus ◽  
Greening Disease

Candidatus Liberibacter asiaticus (CLas), a phloem-limited unculturable Gram-negative bacterium, causes citrus greening disease.

scholarly journals Asian citrus psyllid adults inoculate huanglongbing bacterium more efficiently than nymphs when this bacterium is acquired by early instar nymphs

2020 ◽  
Vol 10 (1) ◽  
Author(s):  
El-Desouky Ammar ◽  
Justin George ◽  
Kasie Sturgeon ◽  
Lukasz L. Stelinski ◽  
Robert G. Shatters
Keyword(s):  
Latent Period ◽  
Salivary Glands ◽  
Emerging Adults ◽  
Citrus Greening ◽  
Asian Citrus Psyllid ◽  
Diaphorina Citri ◽  
Citrus Greening Disease ◽  
Early Instar ◽  
Liberibacter Asiaticus ◽  
Greening Disease

Abstract The Asian citrus psyllid (Diaphorina citri) transmits the bacterium ‘Candidatus Liberibacter asiaticus’ (CLas), which causes huanglongbing (citrus greening) disease, in a circulative-propagative manner. We compared CLas inoculation efficiency of D. citri nymphs and adults into healthy (uninfected) citron leaves when both vector stages were reared from eggs on infected plants. The proportion of CLas-positive leaves was 2.5% for nymphs and 36.3% for adults. CLas acquisition by early instar nymphs followed by dissections of adults and 4th instar nymphs revealed that CLas bacterium had moved into the head-thorax section (containing the salivary glands) in 26.7–30.0% of nymphs and 37–45% of adults. Mean Ct values in these sections were 31.6–32.9 and 26.8–27.0 for nymphs and adults, respectively. Therefore, CLas incidence and titer were higher in the head-thorax of adults than in nymphs. Our results suggest that following acquisition of CLas by early instar D. citri nymphs, emerging adults inoculate the bacteria into citrus more efficiently than nymphs because adults are afforded a longer latent period necessary for multiplication and/or translocation of CLas into the salivary glands of the vector. We propose that CLas uses D. citri nymphs mainly for pathogen acquisition and multiplication, and their adults mainly for pathogen inoculation and spread.

scholarly journals First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan

Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 448-448 ◽  
Author(s):  
Y. S. Ahlawat ◽  
V. K. Baranwal ◽  
Thinlay ◽  
Doe Doe ◽  
S. Majumder
Keyword(s):  
Citrus Greening ◽  
Ribosomal Protein Genes ◽  
Candidatus Liberibacter Asiaticus ◽  
African Countries ◽  
First Report ◽  
Citrus Greening Disease ◽  
Pcr Product ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Greening Disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

scholarly journals Production of monoclonal antibody against Ompa protein of Candidatus Liberibacter asiaticus causing citrus greening disease

2020 ◽  
Vol 18 (3) ◽  
pp. 529-541
Author(s):  
Ho Thi Thuong ◽  
Nguyen Thi Thom ◽  
Nguyen Thi Tra ◽  
Trinh Thai Vy ◽  
Pham Bich Ngoc ◽  
...  
Keyword(s):  
Strong Interaction ◽  
Research Direction ◽  
Citrus Greening ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Ompa Protein ◽  
Greening Disease ◽  
Vhh Antibodies

Citrus Greening, also known as HuangLongbing (HLB), is considered one of the most dangerous citrus diseases, and limiting the production of citrus trees all over the world. Production of antibodies against Ompa protein of Candidatus Liberibacter asiaticus (CLas) for detection of citrus greening disease is considered as promising research direction. In this study, for the purpose of producting antibodies against Ompa of CLas, we firstly used the camel VHH antibody library for screening VHH antibodies against Ompa using phage-display technique. Next, phages which had strong interaction with Ompa as shown in ELISA were selected for phagemid isolation and the DNA fragments encoding VHH antibodies were sequenced. The DNA fragment encoding the best VHH antibody was then selected and inserted into the expression vector pET-21a (+), then cloned in Ecoli DH5α strain and expressed in BL21 (DE3) strain. The expression of VHH antibodies against Ompa was optimized at different temperatures with an inductive concentration of 0.1 M IPTG. Anti-Ompa VHH antibodies were purified under denatured conditions then re-folded. The biological activity of the VHH antibody with Ompa antigen was assessed by indirect-ELISA reaction. Results indicated that the VHH antibody had a very strong interaction with the Ompa antigen. This opens up the prospect of applying VHH antibody in the detection of citrus greening disease.

Huanglongbing, Caused by ‘Candidatus Liberibacter asiaticus,’ Detected in New Locations Across Southern and Coastal Georgia

2020 ◽  
Vol 21 (1) ◽  
pp. 31-35
Author(s):  
Jonathan E. Oliver ◽  
Md Emran Ali ◽  
Sumyya Waliullah ◽  
Jake Price ◽  
Jessica Warren ◽  
...  
Keyword(s):  
Citrus Greening ◽  
Molecular Testing ◽  
Citrus Tree ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
New Locations ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Greening Disease ◽  
Southern Georgia

Huanglongbing (HLB) or citrus greening disease is the most devastating disease of citrus worldwide. This disease, caused by the bacterium ‘Candidatus Liberibacter asiaticus’ (CLas), leads to low fruit quality and unproductive trees. In 2008, HLB was found in a residential citrus tree in Savannah, Georgia, and, as a result, the state has been quarantined for this disease since 2009. Nonetheless, little is known about the distribution of CLas within Georgia, even though the commercial planting of citrus in Georgia has increased exponentially in recent years. In 2019, 94 samples from commercial and residential citrus trees within 11 counties in coastal and southern Georgia were collected and tested for the presence of CLas. Molecular testing results revealed the presence of CLas in three counties where HLB had not been previously reported and in 9% of samples overall. This is the first definitive report confirming HLB in southern Georgia counties besides those along the coast.

Sign in / Sign up

Export Citation Format

Share Document