The antiviral effects of acteoside and the underlying IFN-γ-inducing action

2016 ◽  
Vol 7 (7) ◽  
pp. 3017-3030 ◽  
Author(s):  
Xun Song ◽  
Jiang He ◽  
Hong Xu ◽  
Xiao-Peng Hu ◽  
Xu-Li Wu ◽  
...  
Keyword(s):  
T Lymphocytes ◽  
Dependent Manner ◽  
Phenylpropanoid Glycoside ◽  
Antiviral Effects ◽  
Ifn Γ ◽  
Subsets Of T Lymphocytes ◽  
Dose Dependent ◽  
Mouse Lymphocytes

Acteoside, a natural phenylpropanoid glycoside from Kuding Tea, enhanced IFN-γ production in mouse lymphocytes in a dose-dependent manner, particularly in the CD4+ and CD8+ subsets of T lymphocytes.

scholarly journals Interferons and Ribavirin Effectively Inhibit Norwalk Virus Replication in Replicon-Bearing Cells

2007 ◽  
Vol 81 (22) ◽  
pp. 12111-12118 ◽  
Author(s):  
Kyeong-Ok Chang ◽  
David W. George
Keyword(s):  
Mutation Rates ◽  
Sequencing Analysis ◽  
Dependent Manner ◽  
Cell Culture System ◽  
Norwalk Virus ◽  
Antiviral Effects ◽  
A Cell ◽  
Ifn Γ ◽  
Dose Dependent ◽  
Excellent Tool

ABSTRACT The development of effective therapies for noroviral gastroenteritis has been hampered by the absence of a cell culture system. Recently, we reported the generation of Norwalk virus (NV) replicon-bearing cells in BHK21 and Huh-7 cells and demonstrated that alpha interferon (IFN-α) effectively inhibited the replication of NV in these cells. In continuing studies for screening potential antinoroviral agents, we tested IFN-γ and ribavirin for their effects on NV replication in the cells. Like IFN-α, IFN-γ inhibited the replication of NV in the replicon-bearing cells, showing the reduction of the NV genome and proteins in a dose-dependent manner. The effective dose for reducing 50% (ED50) of the NV genome and protein was calculated to be approximately 40 units/ml. When ribavirin was applied to the cells, it effectively reduced the NV genome and protein with the ED50 calculated as approximately 40 μM. The combination of IFN-α and ribavirin showed additive effects on the inhibition of NV replication. With the addition of guanosine to the ribavirin treatment, moderately reversed antiviral effects were observed, suggesting that the ribavirin effect may be associated with the depletion of GTP in the cells. Sequencing analysis of the conserved polymerase regions of NV in the ribavirin-treated (100 μM) and nontreated groups showed that the mutation rates were similar and indicated that ribavirin did not induce catastrophic mutations. The NV replicon-bearing cells provide an excellent tool for screening potential antinoroviral agents, and our results indicated that IFNs and ribavirin may be good therapeutic options for noroviral gastroenteritis.

scholarly journals Streptococcus pneumoniae Autolysis Prevents Phagocytosis and Production of Phagocyte-Activating Cytokines

2009 ◽  
Vol 77 (9) ◽  
pp. 3826-3837 ◽  
Author(s):  
Anna Martner ◽  
Susann Skovbjerg ◽  
James C. Paton ◽  
Agnes E. Wold
Keyword(s):  
Streptococcus Pneumoniae ◽  
Mononuclear Cells ◽  
Human Peripheral Blood ◽  
Interleukin 12 ◽  
Dependent Manner ◽  
Peripheral Blood Mononuclear ◽  
Exact Function ◽  
Ifn Γ ◽  
Dose Dependent

ABSTRACT Streptococcus pneumoniae is a major pathogen in humans. The pathogenicity of this organism is related to its many virulence factors, the most important of which is the thick pneumococcal capsule that minimizes phagocytosis. Another virulence-associated trait is the tendency of this bacterium to undergo autolysis in stationary phase through activation of the cell wall-bound amidase LytA, which breaks down peptidoglycan. The exact function of autolysis in pneumococcal pathogenesis is, however, unclear. Here, we show the selective and specific inefficiency of wild-type S. pneumoniae for inducing production of phagocyte-activating cytokines in human peripheral blood mononuclear cells (PBMC). Indeed, clinical pneumococcal strains induced production of 30-fold less tumor necrosis factor (TNF), 15-fold less gamma interferon (IFN-γ), and only negligible amounts of interleukin-12 (IL-12) compared with other closely related Streptococcus species, whereas the levels of induction of IL-6, IL-8, and IL-10 production were similar. If pneumococcal LytA was inactivated by mutation or by culture in a medium containing excess choline, the pneumococci induced production of significantly more TNF, IFN-γ, and IL-12 in PBMC, whereas the production of IL-6, IL-8, and IL-10 was unaffected. Further, adding autolyzed pneumococci to intact bacteria inhibited production of TNF, IFN-γ, and IL-12 in a dose-dependent manner but did not inhibit production of IL-6, IL-8, and IL-10 in response to the intact bacteria. Fragments from autolyzed bacteria inhibited phagocytosis of intact bacteria and reduced the in vitro elimination of pneumococci from human blood. Our results suggest that fragments generated by autolysis of bacteria with reduced viability interfere with phagocyte-mediated elimination of live pneumococci.

scholarly journals IFN-γ down-regulates the PD-1 expression and assist nivolumab in PD-1-blockade effect on CD8+ T-lymphocytes in pancreatic cancer

BMC Cancer ◽  
2019 ◽  
Vol 19 (1) ◽  
Author(s):  
Guoping Ding ◽  
Tao Shen ◽  
Chen Yan ◽  
Mingjie Zhang ◽  
Zhengrong Wu ◽  
...  
Keyword(s):  
Pancreatic Cancer ◽  
T Lymphocytes ◽  
Ductal Adenocarcinoma ◽  
Cytotoxic Activities ◽  
Dependent Manner ◽  
Concentration Dependent Manner ◽  
Cd8 T Lymphocytes ◽  
Ifn Γ

Abstract Background Pancreatic cancer is characterized by a highly immunosuppressive tumor microenvironment and evasion of immune surveillance. Although programmed cell death 1 receptor (PD-1) blockade has achieved certain success in immunogenic cancers, the responses to the PD-1 antibody are not effective or sustained in patients with pancreatic cancer. Methods Firstly, PD-1 expressions on peripheral CD8+ T-lymphocytes of patients with pancreatic cancer and healthy donors were measured. In in vitro study, peripheral T-lymphocytes were isolated and treated with nivolumab and/or interferon-γ, and next, PD-1-blockade effects, proliferations, cytokine secretions and cytotoxic activities were tested after different treatments. In in vivo study, mice bearing subcutaneous pancreatic cancer cell lines were treated with induced T-lymphocytes and tumor sizes were measured. Results PD-1 protein expression is increased on peripheral CD8+ T cells in patients with pancreatic ductal adenocarcinoma compared with that in health donor. PD-1 expression on CD8+ T-lymphocytes was decreased by nivolumab in a concentration-dependent manner in vitro. IFN-γ could directly down-regulate expression of PD-1 in vitro. Furthermore, the combination therapy of nivolumab and IFN-γ resulted in greatest effect of PD-1-blockde (1.73 ± 0.78), compared with IFN-γ along (18.63 ± 0.82) and nivolumab along (13.65 ± 1.22). Moreover, the effects of nivolumab plus IFN-γ largest promoted the T-lymphocytes function of proliferations, cytokine secretions and cytotoxic activities. Most importantly, T-lymphocytes induced by nivolumab plus IFN-γ presented the best repression of tumor growth. Conclusions IFN-γ plus a PD-1-blockading agent could enhance the immunologic function and might play a crucial role in effective adoptive transfer treatments of pancreatic cancer.

Lenalidomide Strongly Enhances Natural Killer (NK) Cell Mediated Antibody-Dependent Cellular Cytotoxicity (ADCC) of Rituximab Treated Non-Hodkin’s Lymphoma Cell Lines In Vitro.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 3714-3714 ◽  
Author(s):  
Lei Wu ◽  
Peter Schafer ◽  
George Muller ◽  
David Stirling ◽  
J. Blake Bartlett
Keyword(s):  
Nk Cells ◽  
Tumor Cells ◽  
Cell Lines ◽  
Nk Cell ◽  
Dependent Manner ◽  
Activation Markers ◽  
Early Results ◽  
Ifn Γ ◽  
Dose Dependent

Abstract Lenalidomide (Revlimid® is approved for the treatment of transfusion-dependent patients with anemia due to low- or intermediate-1-risk MDS associated with a del 5q cytogenetic abnormality with or without additional cytogenetic abnormalities, and in combination with dexamethasone is for the treatment of multiple myeloma patients who have received at least one prior therapy. Encouraging early results suggest a potential for clinical efficacy in B cell non-Hodgkin’s lymphoma (NHL). Potential mechanisms of action include anti-angiogenic, anti-proliferative and immunomodulatory activities. Lenalidomide has been shown to enhance Th1-type cytokines and T cell and NK cell activation markers in patients with advanced cancers. Furthermore, lenalidomide has been shown to enhance rituximab-mediated protection in a SCID mouse lymphoma model in vivo. We have utilized an in vitro ADCC system to assess the ability of lenalidomide to directly enhance human NK cell function in response to therapeutic antibodies, such as rituximab (chimeric anti-CD20 mAb). Isolated NK cells produced little or no IFN-γ in response to IgG and/or IL-2 or IL-12. However, pre-treatment of NK cells with lenalidomide greatly enhanced IFN-γ production by NK cells in a dose-dependent manner. In a functional ADCC assay, NHL cell lines (Namalwa, Farage & Raji) were pre-coated with rituximab and exposed to NK cells pre-treated with lenalidomide in the presence of either exogenous IL-2 or IL-12. After 4 hours in culture the viability of the tumor cells was assessed. Lenalidomide consistently and synergistically increased the killing of tumor cells in a dose-dependent manner and up to >4-fold compared to rituximab alone. Rituximab alone had only a small effect in this model and there was no killing of cells in the absence of rituximab. The presence of either exogenous IL-2 or IL-12 was required to see enhanced killing by lenalidomide. In cancer patients lenalidomide has been shown to increase serum IL-12 levels and is also known to induce IL-2 production by T cells in vitro. Potential mechanisms for enhanced ADCC include increased signaling through NK FCγ receptors and/or IL-2 or IL-12 receptors. However, we found that these receptors are unaffected by lenalidomide, although downstream effects on NK signaling pathways are likely and are being actively investigated. In conclusion, we have shown that lenalidomide strongly enhances the ability of rituximab to induce ADCC mediated killing of NHL cells in vitro. This provides a strong rationale for combination of these drugs in patients with NHL and CLL.

scholarly journals Effects of Toosendanin on Pregnancy and Uterine Immunity Alterations in Mice

2010 ◽  
Vol 38 (02) ◽  
pp. 319-328 ◽  
Author(s):  
Jian-Lou Zhang ◽  
Wang-Yu Shi ◽  
Wei Zhong ◽  
Ai-Tuan Ma ◽  
Xiao-Dan Wang ◽  
...  
Keyword(s):  
T Lymphocytes ◽  
Herbal Medicine ◽  
Chinese Herbal Medicine ◽  
Enzyme Linked Immunosorbent Assay ◽  
Chinese Herbal ◽  
Cd8 T Lymphocytes ◽  
Tnf Α ◽  
Ifn Γ ◽  
Th1 Cytokines ◽  
Dose Dependent

This study was conducted to explore the abortifacient effect and the mechanisms of the Chinese herbal medicine component toosendanin, and to elucidate the significance of the Th1 cytokines IFN-γ and TNF-α, CD4+ and CD8+ T lymphocytes in the occurrence of abortion. Graded doses of toosendanin were given by intraperitoneal injection (i.p.) to mice at day 5, 6, 7 of gestation. The levels of Th1 cytokines (IFN-γ, TNF-α) in serum and uterine tissues from mice sacrificed at day 8 were analyzed by enzyme linked immunosorbent assay (ELISA). Presence of T lymphocytes in endometrium was detected by immunohistochemistry. The results revealed that injection of toosendanin could produce a dose-dependent toxicity. The IFN-γ, TNF-α content in serum and uterine tissues were increased significantly. The CD4+ and CD8+ T lymphocytes were also increased in the endometrium of toosendanin treated groups. In conclusion, toosendanin is pregnancy-toxic to animals and it is relevant to the increased contents of IFN-γ, TNF-α and CD4+, CD8+ T lymphocytes.

scholarly journals 1α,25-Dihydroxyvitamin D3 Supplementation during Pregnancy Is Associated with Allergic Rhinitis in the Offspring by Modulating Immunity

2021 ◽  
Vol 2021 ◽  
pp. 1-12
Author(s):  
Liqing Zhang ◽  
Haifeng Ni ◽  
Zhen Zhou ◽  
Xiaoyang Yuan ◽  
Junbo Xia ◽  
...  
Keyword(s):  
Allergic Rhinitis ◽  
Low Dose ◽  
Treg Cells ◽  
Enzyme Linked Immunosorbent Assay ◽  
Dependent Manner ◽  
Dihydroxyvitamin D3 ◽  
Sterile Saline ◽  
Maternal Supplementation ◽  
Ifn Γ ◽  
Dose Dependent

Background. Maternal supplementation with 1α,25-dihydroxyvitamin D3 (VD3) has immunologic effects on the developing fetus through multiple pathways. This study was aimed at investigating the effects of VD3 supplementation on immune dysregulation in the offspring during allergic rhinitis. Methods. Different doses of VD3 as well as control were given to pregnant female mice. Ovalbumin (OVA) challenge and aluminum hydroxide gel in sterile saline were used to induce allergic rhinitis in offspring mice. Nasal lavage fluids (NLF) were collected, and eosinophils were counted in NLF 24 hours after the OVA challenge. Th1, Th2, Th17, and Treg subtype-relevant cytokines, including IFN-γ, IL-4, IL-10, IL-17, TGF-β, and OVA-IgE levels from the blood and NLF of offspring mice, were detected by the enzyme-linked immunosorbent assay (ELISA) method. The Treg subtype was analyzed by flow cytometry. Treg cells were purified from offspring and were adoptively transferred to OVA-sensitized allogenic offspring mice. The outcomes were assessed in allogenic offspring. Results. Our data showed that VD3 supplementation significantly decreased the number of eosinophils, basophils, and lymphocytes in the peripheral blood and NLF. The proportion of CD4+CD25+FoxP3+Tregs had a positive correlation with VD3 in a dose-dependent manner. The levels of serum IgE, IL-4, and IL-17 were decreased while the expressions of IFN-γ, IL-10, and TGF-β were significantly enhanced in VD3 supplementation groups. Adoptive transfer CD4+CD25+FoxP3+Tregs of VD3 supplementation groups promoted Th1 and suppressed Th2 responses in the offspring during allergic rhinitis. Conclusion. Our findings indicated that low dose VD3 supply in pregnant mice’s diet suppressed Th2 and Th17 responses in allergic rhinitis by elevating the Th1 subtype and the proportion of CD4+CD25+FoxP3+Tregs in offspring. It suggested that low dose VD3 supply may have the potential to act as a new therapeutic strategy for allergic rhinitis.

The Anti-inflammatory Effects of Lignan Glycosides from Cistanche tubulosa stems on LPS/IFN-γ-induced RAW264.7 Macrophage Cells via PI3K/AKT Pathway

2020 ◽  
Vol 21 ◽  
Author(s):  
Jinhan Guo ◽  
Shuming Tang ◽  
Yuyang Miao ◽  
Lanlan Ge ◽  
Junfa Xu ◽  
...  
Keyword(s):  
Raw264.7 Cells ◽  
Akt Pathway ◽  
No Production ◽  
Dependent Manner ◽  
Ifn Γ ◽  
Cox 2 ◽  
Cistanche Tubulosa ◽  
Anti Inflammatory ◽  
Lignan Glycosides ◽  
Dose Dependent

Background: Cistanche tubulosa is a tonic in traditional Chinese medicines and has a broad spectrum of biological activity, including anti-inflammatory. However, its anti-inflammatory major constituents of C. tubulosa and their underlying mechanisms are still unknown. Objective: The aim of the current study was to explore the separation and structural characterization of lignan glycosides from C. tubulosa (Schenk) Wight., their anti-inflammatory activity and underlying mechanism. Materials and Methods: Fractionation and isolation of the 85% EtOH extract of C. tubulosa (Schenk) Wight. were carried out and the primary ingredients lignan glycosides (1-6) were structurally characterized. CCK8 methods were used to evaluate the cytotoxic effect of lignan glycosides (1-6). Effects of lignan glycosides (1-6) on NO production in LPS/IFN-γ-induced RAW264.7 macrophages cells were measured using Griess reagent by reaction with nitrite. The mRNA expression levels of iNOS, COX-2, IL-1β, IL-6, TNF-a, and TGF-β treated RAW264.7 cells with various concentrations (0, 25 and 50 μg/ml) of lignan glycosides (1, 4) in the presence of LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 24 h were analyzed by quantitative RT-PCR. Also the protein expressions of iNOS, COX-2, PI3K, AKT, p-AKT and β-actin were determined using Western blot analysis. A molecular docking study was performed to investigate the interactions between the lignan glycosides and the PI3K using Autodock vina 1.1.2 package. Results: Six lignan glycosides (1-6) were isolated from stems of C. tubulosa. Among them, (+)-pinoresinol-4-O-β-D-glucopyranosyl- (1→6)-β-D- glucopyranoside (5) and eleutheroside E (6) were firstly isolated from C. tubulosa. Of these lignans, 1 and 4 exhibited pronounced inhibitions on NO production with the values of 33.63 ± 4.78 and 39.28 ± 5.52 % at 50 μg/ml, respectively. Additionally, LPS/IFN-γ-induced expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-a (TNF-a) was significantly suppressed by pre-treatment of 1 and 4 in a dose-dependent manner. While 1 and 4 increased the mRNA levels of anti-inflammatory cytokines (TGF-β). Furthermore, 1 and 4 significantly inhibited the protein levels of PI3K and p-AKT in a dose-dependent manner. Conclusion: Taken together, these results suggest that 1 and 4 play an important role in the attenuation of LPS/IFN-γ-induced inflammatory responses in RAW264.7 cells and that the mechanisms involve down-regulation of the PI3K/AKT pathway.

Identification of a Functional Interferon-Gamma Response Element in the Fibrinogen FGG Gene.

Blood ◽  
2009 ◽  
Vol 114 (22) ◽  
pp. 3174-3174
Author(s):  
Chantelle M. Rein ◽  
David H. Farrell
Keyword(s):  
Hepg2 Cells ◽  
Transforming Growth Factor ◽  
Conflicts Of Interest ◽  
Consensus Sequence ◽  
Luciferase Reporter ◽  
Luciferase Expression ◽  
Dependent Manner ◽  
Down Regulation ◽  
Ifn Γ ◽  
Dose Dependent

Abstract Abstract 3174 Poster Board III-114 Fibrinogen is the zymogen precursor to the main structural protein in blood coagulation, and is proteolytically activated during coagulation to form fibrin clots. Fibrinogen is an acute phase protein that is produced by the liver, and elevated fibrinogen levels are a known risk factor for cardiovascular disease, including heart attack and stroke. Fibrinogen is synthesized from three separate genes, FGA, FGB, and FGG encoding the Aαa, Bβ, and γ chains, respectively. Several inflammatory cytokines, particularly interleukin-6 (IL-6), are known to up-regulate fibrinogen synthesis, while interleukin-1β, tumor necrosis factor-αa, and transforming growth factor-β are known to antagonize IL-6 stimulation of fibrinogen synthesis. Here we report that interferon-γ (IFN-γ), a cytokine that is highly expressed in atherosclerotic lesions, decreases the production of fibrinogen by two-fold over a 24 hour period in HepG2 hepatocellular carcinoma cells, both at the protein and mRNA level. In addition, IFN-γ antagonizes IL-6 up-regulation of fibrinogen production. Since IFN-γ is known to signal via the IFN-γ receptor through a STAT1-dependent pathway, we investigated the mechanism by which IFN-γ inhibits fibrinogen production. We identify a previously unknown IFN-γ activation sequence (GAS), AGGAGCTTACATAAAGGGACAA, within the promoter of the human γ chain gene FGG. This sequence is homologous to the known GAS consensus sequence TTNCNNNAA. Nuclear extracts from IFN-γ-stimulated HepG2 cells, but not from unstimulated HepG2 cells, form a complex with oligonucleotides containing this GAS sequence, as demonstrated by electrophoretic mobility shift assays. The formation of this complex is blocked by unlabeled competing oligonucleotides and by an antibody to phosphorylated STAT1. The involvement of pSTAT1 in this complex is consistent with the known role of pSTAT1 downstream of IFN-γ receptor signaling. In addition, IFN-γ stimulates STAT1 phosphorylation in a dose-dependent manner in HepG2 cells. Furthermore, using an FGG promoter construct fused to a luciferase reporter gene in transiently transfected HepG2 cells, we show that IFN-γ inhibits luciferase expression in a dose-dependent manner. Together, these data demonstrate that IFN-γ down-regulation of fibrinogen production occurs through a pSTAT1-mediated pathway. Since IFN-γ is known to demonstrate both pro and anti-atherogenic actions, this down-regulation of fibrinogen production may serve an anti-atherogenic function in vivo. Disclosures No relevant conflicts of interest to declare.

scholarly journals Temporal Regulation of Interleukin-12p70 (IL-12p70) and IL-12-Related Cytokines in Splenic Dendritic Cell Subsets during Leishmania donovani Infection

2007 ◽  
Vol 76 (1) ◽  
pp. 239-249 ◽  
Author(s):  
Asher Maroof ◽  
Paul M. Kaye
Keyword(s):  
Cell Differentiation ◽  
T Cell ◽  
Leishmania Donovani ◽  
Dependent Manner ◽  
Th1 Cell ◽  
Mrna Accumulation ◽  
Temporal Regulation ◽  
Specific Accumulation ◽  
Ifn Γ ◽  
Dose Dependent

ABSTRACT Dendritic cells (DC) play an essential role in initiating and directing T-cell responses, in part by production of interleukin-12p70 (IL-12p70), IL-23, and IL-27. However, comparative studies on the capacity for cytokine production of DC subsets are rare. Here, we compare splenic CD8α+, CD4+, and double-negative (DN) DC, isolated 5 h to 28 days after Leishmania donovani infection, for (i) production of IL-12p70, (ii) accumulation of IL-12/23p40, IL-12p35, IL-23p19, and IL-27p28 mRNAs, and (iii) their capacity to direct CD4+ T-cell differentiation. At 5 h, conventional DC (cDC) accumulated mRNA for IL-12/23p40 (CD8α>CD4>DN), IL-23p19 (CD4>CD8α>DN), and IL-27p28 (CD8α>CD4>DN), in an infection dose-dependent manner. IL-12p70 was restricted to CD8α+ cDC, reflecting the subset-specific accumulation of IL-12p35 mRNA. In contrast, cDC from mice infected for 14 to 28 days accumulated little mRNA for IL-12p40 and IL-12p19, though IL-27p28 mRNA remained detectable (CD8α>DN>CD4). IL-12p70 secretion by CD8α+ cDC was also absent, reflecting deficient IL-12/23p40, rather than IL-12p35, mRNA accumulation. The capacity of CD8α+ cDC isolated early after infection to direct Th1 cell differentiation was mediated through IL-12/23p40, whereas this ability in CD4+ and DN cDC was independent of IL-12/23p40 and did not result from overexpression of Delta 4 Notch-like ligand. However, DN cDC produced gamma interferon (IFN-γ) and also contained a rare population of CD11chi DX5+ IFN-γ-producing cells. Our data illustrate the extensive diversity in, and temporal regulation of, splenic cDC subsets during infection and suggest caution in interpreting data obtained with unfractionated or minimally purified DC.

scholarly journals TNF-αPromotes IFN-γ-Induced CD40 Expression and Antigen Process in Myb-Transformed Hematological Cells

2012 ◽  
Vol 2012 ◽  
pp. 1-11 ◽  
Author(s):  
Wenyi Gu ◽  
Jiezhong Chen ◽  
Lei Yang ◽  
Kong-Nan Zhao
Keyword(s):  
Dendritic Cells ◽  
Tumour Necrosis Factor ◽  
Tumour Necrosis ◽  
Mixed Lymphocyte Reaction ◽  
Interleukin 4 ◽  
Dependent Manner ◽  
Ifn Γ ◽  
Cd40 Expression ◽  
Dose Dependent ◽  
Necrosis Factor

Tumour necrosis factor-α, interferon-γand interleukin-4 are critical cytokines in regulating the immune responses against infections and tumours. In this study, we investigated the effects of three cytokines on CD40 expression in Myb-transformed hematological cells and their regulatory roles in promoting these cells into dendritic cells. We observed that both interleukin-4 and interferon-γincreased CD40 expression in these hematological cells in a dose-dependent manner, although the concentration required for interleukin-4 was significantly higher than that for interferon-γ. We found that tumour necrosis factor-αpromoted CD40 expression induced by interferon-γ, but not by interleukin-4. Our data showed that tumour necrosis factor-αplus interferon-γ-treated Myb-transformed hematological cells had the greatest ability to take up and process the model antigen DQ-Ovalbumin. Tumour necrosis factor-αalso increased the ability of interferon-γto produce the mixed lymphocyte reaction to allogenic T cells. Furthermore, only cotreatment with tumour necrosis factor-αand interferon-γinduced Myb-transformed hematological cells to express interleukin-6. These results suggest that tumour necrosis factor-αplays a key regulatory role in the development of dendritic cells from hematological progenitor cells induced by interferon-γ.

Sign in / Sign up

Export Citation Format

Share Document