Abstract
The introduction of nonmyeloablative/reduced intensity conditionings has increased the eligible age for allografting up to 65–70 years. The thymic function is fundamental for the generation of T-cell diversity following allografting even though it is generally considered to decline with age. Until recently, thymic function could not be monitored as a consequence of the absence of adequate technology to differentiate true recent thymic emigrants from naive T cells. The generation of TCR diversity occurs in the thymus through the recombination of gene segments encoding the variable parts of the TCR alpha and beta chains. During this process, by-products of the rearrangements are generated in the form of signal joint T-cell receptor excision circles (sjTRECs). As sjTRECs are stable extrachromosomal DNA fragments, they are not replicated during mitosis and thus diluted with each round of cell division. They are therefore more frequent in T cells that have recently left the thymus.
Thymic output was assessed in 52 patients, median age 50 (range 26–67) years, conditioned with low dose TBI (200 cGy), with/without fludarabine (90 mg/m2 total), or cyclophosphamide-thiotepa followed by G-CSF mobilised peripheral blood stem cell infusion from HLA identical siblings or volunteer donors. Diagnoses included: multiple myeloma (no=36), acute myeloid leukemia (no=2), myelodisplastic syndrome (no=4), chronic myeloid leukemia (no=1), Hodgkin disease (no=3), and chronic lymphocytic leukemia (no=6).
Genomic DNA was purified from highly enriched CD3–CD4 pos and CD3–CD8 pos T cells by cell sorting (median purity: 97%) at 3, 6, 12, 18 and 24 months post-transplant. Real Time PCR analysis was performed with sjTREC specific primers: forward 5′-TGGTTTTTGTAAAGGTGCCCAC-3′ (50nM), reverse 5′-GTGCCAGCTGCAGGGTTT-3′ (50nM) and the oligo 5′(FAM) CATAGGCACCTGCACCCCGTGC(TAMBRA)p-3′ (250nM) as a detection probe. The GAPDH gene was amplified to standardize DNA content. Amplification reactions (25μl) contained 100ng of genomic DNA, TaqMan universal PCR master mix (Perkin Elmer Applied Biosystems, Foster City, CA, USA), and the appropriate primers and probes. All reactions were performed in the Model 7900 Sequence Detector using standard parameters and analysed using the GeneAmp software (Perkin Elmer Apllied Biosystems). All samples were measured in duplicate PCR reactions.
Median sjTRECs values/100 ng DNA from CD3–CD4 pos T cells were as follows: 5.47; 7.09; 11.05; 15.42; 30.45 at 3, 6, 12, 18 and 24 months respectively, while sjTRECs values/100 ng DNA from CD3–CD8 pos T cells were as follows: 2.95; 2.33; 6.64; 10.49; 12.65 at 3, 6, 12, 18 and 24 months respectively. Healthy donors had significantly higher sjTRECs values at the time of donation compared to recipients. Importantly, sjTRECs were not detected in a 60-year-old leukemic patient thymectomized 10 years before allografting for a thymoma. CDR3 spectratyping analysis, evaluated on cDNA samples from the same T cell populations showed an oligoclonal pattern of the TCR repertoire during the first 6 months post-transplant that gradually expanded.
The recovery of naive CD4+CD62L+CD45RA+bright T cells and of memory CD4+CD62L+CD45R0+bright T cells, evaluated by flow cytometry, was also gradual over the two-year period. A significant correlation between the levels of sjTRECs and the number of very naive CD62L + T cells was observed (p<0.0001).
Correlation between the thymic activity and clinical variables such as graft-vs-host disease, graft-vs-tumor effects and infections are being evaluated and will be presented at the meeting.
Overall, our findings provide evidence that adult thymus activity contributes to a slow T cell immune reconstitution during the first two years post-transplant. To enhance the thymus activity, future therapeutic interventions with agents such as recombinant human keratinocyte growth factor-1 or IL-7 may be investigated in clinical phase I trials.
Thymic function in the regulation of T cells, and molecular mechanisms underlying the modulation of cytokines and stress signaling