Levels of nitric oxide, gamma interferon and interleukin-12 in AIDS patients with toxoplasmic encephalitis

Infection ◽  
1999 ◽  
Vol 27 (3) ◽  
pp. 218-220 ◽  
Author(s):  
D. Torre ◽  
C. Zeroli ◽  
G. Ferrario ◽  
A. Pugliese ◽  
F. Speranza ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
Gamma Interferon ◽  
Toxoplasmic Encephalitis ◽  
Interleukin 12 ◽  
Aids Patients

scholarly journals Immunohistochemical Analysis of Cellular Infiltrate and Gamma Interferon, Interleukin-12, and Inducible Nitric Oxide Synthase Expression in Leprosy Type 1 (Reversal) Reactions before and during Prednisolone Treatment

2001 ◽  
Vol 69 (5) ◽  
pp. 3413-3417 ◽  
Author(s):  
David Little ◽  
Saroj Khanolkar-Young ◽  
Anne Coulthart ◽  
Sujai Suneetha ◽  
Diana N. J. Lockwood
Keyword(s):  
Nitric Oxide ◽  
Nitric Oxide Synthase ◽  
Inducible Nitric Oxide Synthase ◽  
Immunohistochemical Analysis ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
Prednisolone Treatment ◽  
Oxide Synthase ◽  
Inducible Nitric Oxide

ABSTRACT The effects of prednisolone treatment on the cellularity and cytokine (gamma interferon, interleukin-12, and inducible nitric oxide synthase) profiles of leprosy skin type 1 (reversal) reactions were studied using immunohistochemistry. Skin biopsies were taken from 15 patients with leprosy type 1 (reversal) reactions at days 0, 7, 28, and 180 after the start of steroid treatment. Prednisolone treatment had little effect at day 7, but by day 28 significant decreases were found in cytokine levels. Some patients maintained cytokine production at days 28 and 180. These results illustrate the strong Th1 profile of type 1 reactional lesions, the slow response to steroid therapy, and continuing activity at 180 days.

scholarly journals Interleukin-12 Is Required for Control of the Growth of Attenuated Aromatic-Compound-Dependent Salmonellae in BALB/c Mice: Role of Gamma Interferon and Macrophage Activation

1998 ◽  
Vol 66 (10) ◽  
pp. 4767-4776 ◽  
Author(s):  
Pietro Mastroeni ◽  
J. A. Harrison ◽  
J. H. Robinson ◽  
S. Clare ◽  
S. Khan ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
Nitric Oxide Synthase ◽  
Mononuclear Cells ◽  
Gamma Interferon ◽  
Biologically Active ◽  
Interleukin 12 ◽  
Spleen Cells ◽  
Tissue Homogenates ◽  
Ifn Γ ◽  
Oxide Synthase

ABSTRACT The attenuated S. typhimurium SL3261 (aroA) strain causes mild infections in BALB/c mice. We were able to exacerbate the disease by administering anti-interleukin-12 (IL-12) antibodies, resulting in bacterial counts in the spleens and livers of anti-IL-12-treated mice that were 10- to 100-fold higher than the ones normally observed in premortem mice; yet the animals showed only mild signs of illness. Nevertheless, they eventually died of a slow, progressive disease. Mice infected with salmonellae become hypersusceptible to endotoxin. We found that IL-12 neutralization prevented the death of infected mice following subcutaneous injection of lipopolysaccharide. Granulomatous lesions developed in the spleens and livers of control animals, as opposed to a widespread infiltration of mononuclear cells seen in the organs of anti-IL-12-treated mice. In the latter (heavily infected), salmonellae were seen within mononuclear cells, indicating an impairment of the bactericidal or bacteriostatic ability of the phagocytes in the absence of biologically active IL-12. Gamma interferon (IFN-γ) levels were reduced in the sera and tissue homogenates from anti-IL-12-treated mice compared to those in control animals. Furthermore, fluorescence-activated cell sorter analysis on spleen cells showed that IL-12 neutralization impaired the upregulation of I-Ad/I-Ed antigens on macrophages from infected mice. Inducible nitric oxide synthase and IFN-γ mRNA production was down-regulated in anti-IL-12-treated mice, which also showed an increased production of IL-10 mRNA and a decrease in nitric oxide synthase activity in the tissues. Administration of recombinant IFN-γ to anti-IL-12-treated mice was able to restore host resistance, granuloma formation, and expression of major histocompatibility complex class II antigens in F4/80+ and CD11b+ spleen cells.

scholarly journals Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

2001 ◽  
Vol 69 (3) ◽  
pp. 1643-1649 ◽  
Author(s):  
Robert A. Gramzinski ◽  
Denise L. Doolan ◽  
Martha Sedegah ◽  
Heather L. Davis ◽  
Arthur M. Krieg ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
T Cells ◽  
Nk Cells ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Interleukin 12 ◽  
Cpg Odn ◽  
Cpg Dinucleotides ◽  
Cpg Odns ◽  
Ifn Γ

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

scholarly journals The role of interleukin 12 and nitric oxide in the development of spontaneous autoimmune disease in MRL/MP-lpr/lpr mice.

1996 ◽  
Vol 183 (4) ◽  
pp. 1447-1459 ◽  
Author(s):  
F P Huang ◽  
G J Feng ◽  
G Lindop ◽  
D I Stott ◽  
F Y Liew
Keyword(s):  
Nitric Oxide ◽  
Autoimmune Disease ◽  
Cultured Cells ◽  
Daily Injection ◽  
Interleukin 12 ◽  
No Production ◽  
Necrosis Factor Alpha ◽  
Ifn Gamma ◽  
Peritoneal Cells ◽  
High Concentrations

MRL/MP-lpr/lpr (MRL/lpr) mice develop a spontaneous autoimmune disease. Serum from these mice contained significantly higher concentrations of nitrite/nitrate than serum from age-matched control MRL/MP-+/+ (MRL/+), BALB/c or CBA/6J mice. Spleen and peritoneal cells from MRL/lpr mice also produced significantly more nitric oxide (NO) than those from the control mice when cultured with interferon (IFN) gamma and lipopolysaccharide (LPS) in vitro. It is interesting to note that peritoneal cells from MRL/lpr mice also produced markedly higher concentrations of interleukin (IL) 12 than those from MRL/+ or BALB/c mice when cultured with same stimuli. It is striking that cells from MRL/lpr mice produced high concentrations of NO when cultured cells from MRL/+ or BALB/c mice. The enhanced NO synthesis induced by IFN-gamma/LPS was substantially inhibited by anti-IL-12 antibody. In addition, IL-12-induced NO production can also be markedly inhibited by anti-IFN-gamma antibody, but only weakly inhibited by anti-tumor necrosis factor alpha antibody. The effect of IL-12 on NO production was dependent on the presence of natural killer and possibly T cells. Serum from MRL/lpr mice contained significantly higher concentrations of IL-12 compared with those of MRL/+ or BALB/c control mice. Daily injection of recombinant IL-12 led to increased serum levels of IFN-gamma and NO metabolites, and accelerated glomerulonephritis in the young MRL/lpr mice (but not in the MRL/+ mice) compared with controls injected with phosphate-buffered saline alone. These data, together with previous finding that NO synthase inhibitors can ameliorate autoimmune disease in MRL/lpr mice, suggest that high capacity of such mice to produce IL-12 and their greater responsiveness to IL-12, leading to the production of high concentrations of NO, are important factors in this spontaneous model of autoimmune disease.

scholarly journals Influenza Virus Vaccination Induces Interleukin-12/23 Receptor β1 (IL-12/23Rβ1)-Independent Production of Gamma Interferon (IFN-γ) and Humoral Immunity in Patients with Genetic Deficiencies in IL-12/23Rβ1 or IFN-γ Receptor I

2008 ◽  
Vol 15 (8) ◽  
pp. 1171-1175 ◽  
Author(s):  
Tjitske de Boer ◽  
Jaap T. van Dissel ◽  
Taco W. J. Kuijpers ◽  
Guus F. Rimmelzwaan ◽  
Frank P. Kroon ◽  
...  
Keyword(s):  
Influenza Virus ◽  
T Cell ◽  
Seasonal Influenza ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
Virus Vaccination ◽  
Cell Responses ◽  
Antibody Titers ◽  
Ifn Γ ◽  
Striking Contrast

ABSTRACT To investigate whether protective immune responses can be induced in the absence of normal interleukin-12/23/gamma interferon (IL-12/23/IFN-γ) axis signaling, we vaccinated with the seasonal influenza virus subunit vaccine two patients with complete IL-12/23 receptor β1 (IL-12/23Rβ1) deficiencies, two patients with partial IFN-γ receptor I (pIFN-γRI) deficiencies, and five healthy controls. Blood samples were analyzed before, 7 days after, and 28 days after vaccination. In most cases, antibody titers reached protective levels. Moreover, although T-cell responses in patients were lower than those observed in controls, significant influenza virus-specific T-cell proliferation, IFN-γ production, and numbers of IFN-γ-producing cells were found in all patients 7 days after the vaccination. Interestingly, influenza virus-specific IFN-γ responses were IL-12/23 independent, in striking contrast to mycobacterium-induced IFN-γ production. In conclusion, influenza virus vaccination induces IL-12/23-independent IFN-γ production by T cells and can result in sufficient humoral protection in both IL-12/23Rβ1- and pIFN-γRI-deficient individuals.

scholarly journals Resistance to Acute Babesiosis Is Associated with Interleukin-12- and Gamma Interferon-Mediated Responses and Requires Macrophages and Natural Killer Cells

2003 ◽  
Vol 71 (4) ◽  
pp. 2002-2008 ◽  
Author(s):  
Irma Aguilar-Delfin ◽  
Peter J. Wettstein ◽  
David H. Persing
Keyword(s):  
Nk Cells ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
No Production ◽  
Cytokine Responses ◽  
Early Production ◽  
Ifn Γ ◽  
Crucial Part

ABSTRACT We examined the role of the cytokines gamma interferon (IFN-γ) and interleukin-12 (IL-12) in the model of acute babesiosis with the WA1 Babesia. Mice genetically deficient in IFN-γ-mediated responses (IFNGR2KO mice) and IL-12-mediated responses (Stat4KO mice) were infected with the WA1 Babesia, and observations were made on the course of infection and cytokine responses. Levels of IFN-γ and IL-12 in serum increased 24 h after parasite inoculation. The augmented susceptibility observed in IFNGR2KO and Stat-4KO mice suggests that the early IL-12- and IFN-γ-mediated responses are involved in protection against acute babesiosis. Resistance appears to correlate with an increase in nitric oxide (NO) production. In order to assess the contribution of different cell subsets to resistance against the parasite, we also studied mice lacking B cells, CD4+ T cells, NK cells, and macrophages. Mice genetically deficient in B lymphocytes or CD4+ T lymphocytes were able to mount protective responses comparable to those of immunosufficient mice. In contrast, in vivo depletion of macrophages or NK cells resulted in elevated susceptibility to the infection. Our observations suggest that a crucial part of the response that protects from the pathogenic Babesia WA1 is mediated by macrophages and NK cells, probably through early production of IL-12 and IFN-γ, and induction of macrophage-derived effector molecules like NO.

scholarly journals Toxoplasma gondii Cyclophilin 18-Mediated Production of Nitric Oxide Induces Bradyzoite Conversion in a CCR5-Dependent Manner

2009 ◽  
Vol 77 (9) ◽  
pp. 3686-3695 ◽  
Author(s):  
Hany M. Ibrahim ◽  
Hiroshi Bannai ◽  
Xuenan Xuan ◽  
Yoshifumi Nishikawa
Keyword(s):  
Nitric Oxide ◽  
Toxoplasma Gondii ◽  
Inflammatory Responses ◽  
Interleukin 12 ◽  
Dependent Manner ◽  
Independent Manner ◽  
Necrosis Factor Alpha ◽  
Parasite Multiplication ◽  
Factor Alpha

ABSTRACT Toxoplasma gondii modulates pro- and anti-inflammatory responses to regulate parasite multiplication and host survival. Pressure from the immune response causes the conversion of tachyzoites into slowly dividing bradyzoites. The regulatory mechanisms involved in this switch are poorly understood. The aim of this study was to investigate the immunomodulatory role of T. gondii cyclophilin 18 (TgCyp18) in macrophages and the consequences of the cellular responses on the conversion machinery. Recombinant TgCyp18 induced the production of nitric oxide (NO), interleukin-12 (IL-12), and tumor necrosis factor alpha through its binding with cysteine-cysteine chemokine receptor 5 (CCR5) and the production of gamma interferon and IL-6 in a CCR5-independent manner. Interestingly, the treatment of macrophages with TgCyp18 resulted in the inhibition of parasite growth and an enhancement of the conversion into bradyzoites via NO in a CCR5-dependent manner. In conclusion, T. gondii possesses sophisticated mechanisms to manipulate host cell responses in a TgCyp18-mediated process.

scholarly journals Modulation of an Interleukin-12 and Gamma Interferon Synergistic Feedback Regulatory Cycle of T-Cell and Monocyte Cocultures by Porphyromonas gingivalis Lipopolysaccharide in the Absence or Presence of Cysteine Proteinases

2002 ◽  
Vol 70 (10) ◽  
pp. 5695-5705 ◽  
Author(s):  
Peter L. W. Yun ◽  
Arthur A. DeCarlo ◽  
Charles Collyer ◽  
Neil Hunter
Keyword(s):  
T Cells ◽  
T Cell ◽  
Porphyromonas Gingivalis ◽  
Gamma Interferon ◽  
Periodontal Pathogen ◽  
Interleukin 12 ◽  
Minor Role ◽  
Cysteine Proteinases ◽  
Activated T Cells ◽  
Ifn Γ

ABSTRACT Interleukin 12 (IL-12) is an efficient inducer and enhancer of gamma interferon (IFN-γ) production by both resting and activated T cells. There is evidence that human monocytes exposed to IFN-γ have enhanced ability to produce IL-12 when stimulated with lipopolysaccharide (LPS). In this study, it was demonstrated that LPS from the oral periodontal pathogen Porphyromonas gingivalis stimulated monocytes primed with IFN-γ to release IL-12, thereby enhancing IFN-γ accumulation in T-cell populations. P. gingivalis LPS was shown to enhance IL-12 induction of IFN-γ in T cells in a manner independent from TNF-α contribution. The levels of T-cell IL-12 receptors were not affected by P. gingivalis LPS and played only a minor role in the magnitude of the IFN-γ response. These data suggest that LPS from P. gingivalis establishes an activation loop with IL-12 and IFN-γ with potential to augment the production of inflammatory cytokines in relation to the immunopathology of periodontitis. We previously reported that the major cysteine proteinases (gingipains) copurifying with LPS in this organism were responsible for reduced IFN-γ accumulation in the presence of IL-12. However, the addition of the gingipains in the presence of LPS resulted in partial restoration of the IFN-γ levels. In the destructive periodontitis lesion, release of gingipains from the outer membrane (OM) of P. gingivalis could lead to the downregulation of Th1 responses, while gingipain associated with LPS in the OM or in OM vesicles released from the organism could have net stimulatory effects.

scholarly journals Toll-Like Receptor 2 Controls the Gamma Interferon Response to Francisella tularensis by Mouse Liver Lymphocytes

2007 ◽  
Vol 75 (11) ◽  
pp. 5338-5345 ◽  
Author(s):  
Kee-Jong Hong ◽  
Jason R. Wickstrum ◽  
Hung-Wen Yeh ◽  
Michael J. Parmely
Keyword(s):  
Francisella Tularensis ◽  
Cell Types ◽  
Gamma Interferon ◽  
Interferon Response ◽  
Interleukin 12 ◽  
Toll Like Receptor ◽  
Wild Type ◽  
Ifn Γ ◽  
Deficient Mice

ABSTRACT The production of gamma interferon (IFN-γ) is a key step in the protective innate immune response to Francisella tularensis. Natural killer cells and T cells in the liver are important sources of this cytokine during primary F. tularensis infections, and interleukin-12 (IL-12) appears to be an essential coactivating cytokine for hepatic IFN-γ expression. The present study was undertaken to determine whether or not macrophages (Mφ) or dendritic cells (DC) provide coactivating signals for the liver IFN-γ response in vitro, whether IL-12 mediates these effects, and whether Toll-like receptor (TLR) signaling is essential to induce this costimulatory activity. Both bone marrow-derived Mφ and DC significantly augmented the IFN-γ response of F. tularensis-challenged liver lymphocytes in vitro. While both cell types produced IL-12p40 in response to F. tularensis challenge, only DC secreted large quantities of IL-12p70. DC from both IL-12p35-deficient and TLR2-deficient mice failed to produce IL-12p70 and did not costimulate liver lymphocytes for IFN-γ production in response to viable F. tularensis organisms. Conversely, liver lymphocytes from TLR2-deficient mice cocultured with wild-type accessory cells produced IFN-γ at levels comparable to those for wild-type hepatic lymphocytes. These findings indicate that TLR2 controls hepatic lymphocyte IFN-γ responses to F. tularensis by regulating DC IL-12 production. While Mφ also coinduced hepatic IFN-γ production in response to F. tularensis, they did so in a fashion less dependent on TLR2.

The potentiated antileukemic effects of doxorubicin and interleukin-12 combination are not dependent on nitric oxide production

1999 ◽  
Vol 147 (1-2) ◽  
pp. 67-75 ◽  
Author(s):  
Radosław Zagożdżon ◽  
Adam Giermasz ◽  
Jakub Gołąb ◽  
Tomasz Stokłosa ◽  
Ahmad Jalili ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
Interleukin 12 ◽  
Nitric Oxide Production ◽  
Oxide Production
Sign in / Sign up

Export Citation Format

Share Document