scholarly journals The Nucleotide Sequence and Genomic Organization of Citrus Leaf Blotch Virus: Candidate Type Species for a New Virus Genus

Virology ◽  
2001 ◽  
Vol 287 (1) ◽  
pp. 225-233 ◽  
Author(s):  
M.C. Vives ◽  
L. Galipienso ◽  
L. Navarro ◽  
P. Moreno ◽  
J. Guerri
Keyword(s):  
Nucleotide Sequence ◽  
Type Species ◽  
Genomic Organization ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus

scholarly journals Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China

Plant Disease ◽  
2020 ◽  
Author(s):  
Zhiyou Xuan ◽  
Jiaxi Xie ◽  
Haodong Yu ◽  
Song Zhang ◽  
Ruhui Li ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Complete Genome ◽  
Genome Structure ◽  
Viral Agent ◽  
Rt Pcr ◽  
Specific Primer ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus ◽  
Sequence Identities

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches’ broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4–90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5’ and 3’ termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

scholarly journals Dweet Mottle Disease Probably is Caused by Citrus Leaf Blotch Virus

2005 ◽  
Vol 16 (16) ◽  
Author(s):  
M. C. Vives ◽  
J. A. Pina ◽  
J. Juárez ◽  
L. Navarro ◽  
P. Moreno ◽  
...  
Keyword(s):  
Leaf Blotch ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus

scholarly journals Effectiveness of gene silencing induced by viral vectors based on Citrus leaf blotch virus is different in Nicotiana benthamiana and citrus plants

Virology ◽  
2014 ◽  
Vol 460-461 ◽  
pp. 154-164 ◽  
Author(s):  
Jesus Agüero ◽  
María del Carmen Vives ◽  
Karelia Velázquez ◽  
José Antonio Pina ◽  
Luis Navarro ◽  
...  
Keyword(s):  
Gene Silencing ◽  
Nicotiana Benthamiana ◽  
Viral Vectors ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus

scholarly journals Mapping the subgenomic RNA promoter of the Citrus leaf blotch virus coat protein gene by Agrobacterium-mediated inoculation

Virology ◽  
2010 ◽  
Vol 406 (2) ◽  
pp. 360-369 ◽  
Author(s):  
Águeda Renovell ◽  
Selma Gago ◽  
Susana Ruiz-Ruiz ◽  
Karelia Velázquez ◽  
Luis Navarro ◽  
...  
Keyword(s):  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Subgenomic Rna ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
Virus Coat Protein ◽  
Citrus Leaf Blotch Virus ◽  
Virus Coat ◽  
Rna Promoter

scholarly journals First Report of Citrus leaf blotch virus in Sweet Cherry

Plant Disease ◽  
2016 ◽  
Vol 100 (5) ◽  
pp. 1027-1027 ◽  
Author(s):  
J. Wang ◽  
D. Zhu ◽  
Y. Tan ◽  
X. Zong ◽  
H. Wei ◽  
...  
Keyword(s):  
Sweet Cherry ◽  
Leaf Blotch ◽  
First Report ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus

Citrus leaf blotch virus. [Distribution map].

2018 ◽  
Author(s):  
Keyword(s):  
Central America ◽  
New South ◽  
Distribution Map ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
South Wales ◽  
Citrus Leaf Blotch Virus ◽  
Virus Distribution ◽  
New Distribution ◽  
Distribution In Europe

Abstract A new distribution map is provided for Citrus leaf blotch virus. Betaflexiviridae: Citrivirus. Hosts: Citrus spp. Information is given on the geographical distribution in Europe (France, Corsica, Italy, Sicily, Spain), Asia (China, Chongqing, Hunan, Shandong, Sichuan, Zhejiang, Japan), North America (USA, Arkansas, California, Florida, Oregon), Central America & Caribbean (Cuba), Oceania (Australia, New South Wales, New Zealand).

Detection and quantitation of Citrus leaf blotch virus by TaqMan real-time RT-PCR

2009 ◽  
Vol 160 (1-2) ◽  
pp. 57-62 ◽  
Author(s):  
Susana Ruiz-Ruiz ◽  
Silvia Ambrós ◽  
María del Carmen Vives ◽  
Luis Navarro ◽  
Pedro Moreno ◽  
...  
Keyword(s):  
Real Time ◽  
Rt Pcr ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus
Sign in / Sign up

Export Citation Format

Share Document