Polymorphisms in the 5′ Flanking Region of the HFE Gene: Linkage Disequilibrium and Relationship to Iron Homeostasis

2002 ◽  
Vol 28 (2) ◽  
pp. 191-195 ◽  
Author(s):  
Ernest Beutler ◽  
Carol West
Keyword(s):  
Linkage Disequilibrium ◽  
Iron Homeostasis ◽  
Hfe Gene ◽  
Gene Linkage ◽  
Flanking Region

scholarly journals CBIO-10. REDUCED IRON EXPORT FUNCTIONS IN A CELL INTRINSIC MANNER TO DRIVE GLIOBLASTOMA GROWTH

2020 ◽  
Vol 22 (Supplement_2) ◽  
pp. ii17-ii17
Author(s):  
Katie Troike ◽  
Erin Mulkearns-Hubert ◽  
Daniel Silver ◽  
James Connor ◽  
Justin Lathia
Keyword(s):  
Tumor Cells ◽  
Iron Uptake ◽  
Iron Homeostasis ◽  
Iron Status ◽  
Tumor Grade ◽  
Hfe Gene ◽  
Iron Release ◽  
Female Patients ◽  
Cellular Iron

Abstract Glioblastoma (GBM), the most common primary malignant brain tumor in adults, is characterized by invasive growth and poor prognosis. Iron is a critical regulator of many cellular processes, and GBM tumor cells have been shown to modulate expression of iron-associated proteins to enhance iron uptake from the surrounding microenvironment, driving tumor initiation and growth. While iron uptake has been the central focus of previous investigations, additional mechanisms of iron regulation, such as compensatory iron efflux, have not been explored in the context of GBM. The hemochromatosis (HFE) gene encodes a transmembrane glycoprotein that aids in iron homeostasis by limiting cellular iron release, resulting in a sequestration phenotype. We find that HFE is upregulated in GBM tumors compared to non-tumor brain and that expression of HFE increases with tumor grade. Furthermore, HFE mRNA expression is associated with significantly reduced survival specifically in female patients with GBM. Based on these findings, we hypothesize that GBM tumor cells upregulate HFE expression to augment cellular iron loading and drive proliferation, ultimately leading to reduced survival of female patients. To test this hypothesis, we generated Hfe knockdown and overexpressing mouse glioma cell lines. We observed significant alterations in the expression of several iron handling genes with Hfe knockdown or overexpression, suggesting global disruption of iron homeostasis. Additionally, we show that knockdown of Hfe in these cells increases apoptosis and leads to a significant impairment of tumor growth in vivo. These findings support the hypothesis that Hfe is a critical regulator of cellular iron status and contributes to tumor aggression. Future work will include further exploration of the mechanisms that contribute to these phenotypes as well as interactions with the tumor microenvironment. Elucidating the mechanisms by which iron effulx contributes to GBM may inform the development of next-generation targeted therapies.

Novel mutation in ferroportin1 is associated with autosomal dominant hemochromatosis

Blood ◽  
2002 ◽  
Vol 100 (2) ◽  
pp. 692-694 ◽  
Author(s):  
Daniel F. Wallace ◽  
Palle Pedersen ◽  
Jeannette L. Dixon ◽  
Peter Stephenson ◽  
Jeffrey W. Searle ◽  
...  
Keyword(s):  
Iron Transport ◽  
Autosomal Recessive ◽  
Iron Homeostasis ◽  
Autosomal Dominant ◽  
Novel Mutation ◽  
Hfe Gene ◽  
Excess Iron ◽  
Chromosome 1Q ◽  
Australian Family ◽  
Autosomal Recessive Pattern

Abstract Hemochromatosis is a common disorder characterized by excess iron absorption and accumulation of iron in tissues. Usually hemochromatosis is inherited in an autosomal recessive pattern and is caused by mutations in the HFE gene. Less common non-HFE–related forms of hemochromatosis have been reported and are caused by mutations in the transferrin receptor 2 gene and in a gene localized to chromosome 1q. Autosomal dominant forms of hemochromatosis have also been described. Recently, 2 mutations in theferroportin1 gene, which encodes the iron transport protein ferroportin1, have been implicated in families with autosomal dominant hemochromatosis from the Netherlands and Italy. We report the finding of a novel mutation (V162del) in ferroportin1 in an Australian family with autosomal dominant hemochromatosis. We propose that this mutation disrupts the function of the ferroportin1 protein, leading to impaired iron homeostasis and iron overload.

Physiologic systemic iron metabolism in mice deficient for duodenal Hfe

Blood ◽  
2007 ◽  
Vol 109 (10) ◽  
pp. 4511-4517 ◽  
Author(s):  
Maja Vujic Spasic ◽  
Judit Kiss ◽  
Thomas Herrmann ◽  
Regina Kessler ◽  
Jens Stolte ◽  
...  
Keyword(s):  
Iron Metabolism ◽  
Iron Homeostasis ◽  
Iron Absorption ◽  
Binding Capacity ◽  
Hereditary Hemochromatosis ◽  
Direct Interaction ◽  
Hfe Gene ◽  
Hepatic Iron ◽  
Primary Role ◽  
Genes Encoding

Abstract Mutations in the Hfe gene result in hereditary hemochromatosis (HH), a disorder characterized by increased duodenal iron absorption and tissue iron overload. Identification of a direct interaction between Hfe and transferrin receptor 1 in duodenal cells led to the hypothesis that the lack of functional Hfe in the duodenum affects TfR1-mediated serosal uptake of iron and misprogramming of the iron absorptive cells. Contrasting this view, Hfe deficiency causes inappropriately low expression of the hepatic iron hormone hepcidin, which causes increased duodenal iron absorption. We specifically ablated Hfe expression in mouse enterocytes using Cre/LoxP technology. Mice with efficient deletion of Hfe in crypt- and villi-enterocytes maintain physiologic iron metabolism with wild-type unsaturated iron binding capacity, hepatic iron levels, and hepcidin mRNA expression. Furthermore, the expression of genes encoding the major intestinal iron transporters is unchanged in duodenal Hfe-deficient mice. Our data demonstrate that intestinal Hfe is dispensable for the physiologic control of systemic iron homeostasis under steady state conditions. These findings exclude a primary role for duodenal Hfe in the pathogenesis of HH and support the model according to which Hfe is required for appropriate expression of the “iron hormone” hepcidin which then controls intestinal iron absorption.

Physiology of iron transport and the hemochromatosis gene

2002 ◽  
Vol 282 (3) ◽  
pp. G403-G414 ◽  
Author(s):  
Antonello Pietrangelo
Keyword(s):  
Iron Homeostasis ◽  
Cell Damage ◽  
Hereditary Hemochromatosis ◽  
Hfe Gene ◽  
Cell Functions ◽  
Cellular Iron ◽  
Histocompatibility Complex ◽  
Biological Studies ◽  
Hemochromatosis Gene ◽  
Main Protein

Iron is essential for fundamental cell functions but is also a catalyst for chemical reactions involving free radical formation, potentially leading to oxidative stress and cell damage. Cellular iron levels are therefore carefully regulated to maintain an adequate substrate while also minimizing the pool of potentially toxic “free iron.” The main control of body iron homeostasis in higher organisms is placed in the duodenum, where dietary iron is absorbed, whereas no controlled means of eliminating unwanted iron have evolved in mammals. Hereditary hemochromatosis, the prototype of deregulated iron homeostasis in humans, is due to inappropriately increased iron absorption and is commonly associated to a mutated HFE gene. The HFE protein is homologous to major histocompatibility complex class I proteins but is not an iron carrier, whereas biochemical and cell biological studies have shown that the transferrin receptor, the main protein devoted to cellular uptake of transferrin iron, interacts with HFE. This review focuses on recent advances in iron research and presents a model of HFE function in iron metabolism.

scholarly journals HFE gene variants and iron-induced oxygen radical generation in idiopathic pulmonary fibrosis

2014 ◽  
Vol 45 (2) ◽  
pp. 483-490 ◽  
Author(s):  
Federica Sangiuolo ◽  
Ermanno Puxeddu ◽  
Gabriella Pezzuto ◽  
Francesco Cavalli ◽  
Giuliana Longo ◽  
...  
Keyword(s):  
Idiopathic Pulmonary Fibrosis ◽  
Pulmonary Fibrosis ◽  
High Performance ◽  
Iron Homeostasis ◽  
Oxygen Radical ◽  
Hfe Gene ◽  
Gene Variants ◽  
Dot Blot ◽  
Allelic Variants ◽  
Radical Generation

In idiopathic pulmonary fibrosis (IPF), lung accumulation of excessive extracellular iron and macrophage haemosiderin may suggest disordered iron homeostasis leading to recurring microscopic injury and fibrosing damage.The current study population comprised 89 consistent IPF patients and 107 controls. 54 patients and 11 controls underwent bronchoalveolar lavage (BAL). Haemosiderin was assessed by Perls' stain, BAL fluid malondialdehyde (MDA) by high-performance liquid chromatography, BAL cell iron-dependent oxygen radical generation by fluorimetry and the frequency of hereditary haemochromatosis HFE gene variants by reverse dot blot hybridisation.Macrophage haemosiderin, BAL fluid MDA and BAL cell unstimulated iron-dependent oxygen radical generation were all significantly increased above controls (p<0.05). The frequency of C282Y, S65C and H63D HFE allelic variants was markedly higher in IPF compared with controls (40.4% versus 22.4%, OR 2.35, p=0.008) and was associated with higher iron-dependent oxygen radical generation (HFE variant 107.4±56.0, HFE wild type (wt) 59.4±36.4 and controls 16.7±11.8 fluorescence units per 105 BAL cells; p=0.028 HFE variant versus HFE wt, p=0.006 HFE wt versus controls).The data suggest iron dysregulation associated with HFE allelic variants may play an important role in increasing susceptibility to environmental exposures, leading to recurring injury and fibrosis in IPF.

16189 Mitocondrial Variant and Iron Overload.

Blood ◽  
2005 ◽  
Vol 106 (11) ◽  
pp. 3705-3705
Author(s):  
Maria Salvador ◽  
Fernando A. Gonzalez ◽  
Paloma Ropero ◽  
Briceño Olga ◽  
Anguita Eduardo ◽  
...  
Keyword(s):  
Iron Overload ◽  
Mitochondrial Function ◽  
Iron Homeostasis ◽  
Normal Population ◽  
Hypervariable Region ◽  
Hfe Gene ◽  
Compound Heterozygous ◽  
Incomplete Penetrance ◽  
Iron Loading ◽  
Autosomal Recessive Diseases

Abstract Hereditary haemochromatosis(HH) is one of the most common autosomal recessive diseases in Europe, this is characterized by iron overload. There are two predominant mutations associated with the disease in the HFE gene: C282Y and H63D. The majority of haemochromatosis patients are homozygous for C282Y mutation and a small proportion are compound heterozygous C282Y/H63D. Not all C282Y homozygotes and compound heterozygous will show signs of iron loading. Several studies have shown the incomplete penetrance of haemochromatosis and suggest that iron overload is influenced by both enviromental and genetic factors wich may modify the phenotipic expression of the disease. Iron loading is associated with impaired mitochondrial function. It has been reported that the T16189C variant of mitochondrial DNA may act as a modifier increasing iron loading in HH. 16189 variant lies in the first hypervariable region (HV1), close to the sequences controlling replication and transcription. Aim: to determine the frequency of the 16189 variant in normal population and in a group of HH pacients with mutations in HFE gene or iron loading due to Mayor or Intermediate b-Thalassemia. Materials and methods: We stablished the frequence of 16189 variant in normal population by studying it in a group of 102 blood donors which did not have any mutation in HFE gene. We determined the variant in 27 C282Y homozygous, 32 compound heterozygous C282Y/H63D and 31 H63D homozygous and 16 β-thalassemics aswell. DNA was extracted from peripheral blood, HV1 region was amplified by PCR using primers: F(15800–15819)CAAGTAGCATCCGT ACTATA; R(16344–16325)GTAATGTGCTATGTACGGTA The product of amlification was digested with MnlI acording to manufacturer’s specifications. In wild type there is a restriction site at position 16189 which is absent in mutant allele. All samples lacking MnlI site were directly sequenced in a ABI PRISM 310 Genetic Analyzer. Statistical analysis was performed using the SPSS package. Results: shown in table 1 Conclusions: Our results do not show significant differences between the groups analyzed, but no significant increased frequency of the variant in the group of compound heterozygous. With this study we cannot conclude that mitochondrial function influences iron overload. This is could be dued to the short number of samples analyzed. In β-Thalassemia iron loading is modifed by an increased absorption(TM y TI) and transfusions(TM). At the present we are studying other factors that could play an important role in iron homeostasis: Transferrin receptor, Hepcidine and Hemojuveline. Table 1. Results Controls C282Y/C282Y C282Y/H63D H63D/H63D β-Thalassemia 16189C 12% 11.1% 18.7% 6.4% 12.5%

scholarly journals Co-localization of the Mammalian Hemochromatosis Gene Product (HFE) and a Newly Identified Transferrin Receptor (TfR2) in Intestinal Tissue and Cells

2003 ◽  
Vol 51 (5) ◽  
pp. 613-623 ◽  
Author(s):  
William J.H. Griffiths ◽  
Timothy M. Cox
Keyword(s):  
Transferrin Receptor ◽  
Iron Homeostasis ◽  
Receptor Gene ◽  
Hfe Gene ◽  
Transport Pathway ◽  
Intestinal Crypt ◽  
Hemochromatosis Gene ◽  
Small Intestinal ◽  
Potential Interactions ◽  
Crypt Cells

Mutations in the HFE gene and a newly identified second transferrin receptor gene, TfR2, cause hemochromatosis. The cognate proteins, HFE and TfR2, are therefore of key importance in human iron homeostasis. HFE is expressed in small intestinal crypt cells where transferrin-iron entry may determine subsequent iron absorption by mature enterocytes, but the physiological function of TfR2 is unknown. Using specific peptide antisera, we examined the duodenal localization of HFE and TfR2 in humans and mice, with and without HFE deficiency, by confocal microscopy. We also investigated potential interactions of these proteins in human intestinal cells in situ. Duodenal expression of HFE and TfR2 (but not TfR1) in wild-type mice and humans was restricted to crypt cells, in which they co-localized. HFE deficiency disrupted this interaction, altering the cellular distribution of TfR2 in human crypts. In human Caco-2 cells, HFE and TfR2 co-localized to a distinct CD63-negative vesicular compartment showing marked signal enhancement on exposure to iron-saturated transferrin ligand, indicating that HFE preferentially interacts with TfR2 in a specialized early endosomal transport pathway for transferrin-iron. This interaction occurs specifically in small intestinal crypt cells that differentiate to become iron-absorbing enterocytes. Our immunohistochemical findings provide evidence for a novel mechanism for the regulation of iron balance in mammals.

Sign in / Sign up

Export Citation Format

Share Document