scholarly journals First report of a Jujube witches’‐broom phytoplasma (16SrV) strain associated with witches’‐broom and little leaf disease of Solanum melongena in India

2021 ◽  
Vol 43 (2) ◽  
Author(s):  
S.K. Snehi ◽  
S.S. Parihar ◽  
B. Jain
Keyword(s):  
Solanum Melongena ◽  
First Report ◽  
Leaf Disease

scholarly journals First Report of a Group 16SrII Phytoplasma Associated with Witches'-Broom of Eggplant in Oman

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 360-360 ◽  
Author(s):  
A. M. Al-Subhi ◽  
N. A. Al-Saady ◽  
A. J. Khan ◽  
M. L. Deadman
Keyword(s):  
Nested Pcr ◽  
Solanum Melongena ◽  
Positive Control ◽  
Rrna Gene ◽  
Direct Pcr ◽  
First Report ◽  
Pcr Product ◽  
Pcr Products ◽  
Broom Disease ◽  
Phytoplasma Infection

Eggplant (Solanum melongena L.) belongs to the family Solanaceae and is an important vegetable cash crop grown in most parts of Oman. In February 2010, plants showing phyllody symptoms and proliferation of shoots resembling those caused by phytoplasma infection were observed at Khasab, 500 km north of Muscat. Total genomic DNA was extracted from healthy and two symptomatic plants with a modified (CTAB) buffer method (2) and analyzed by direct and nested PCR with universal phytoplasma 16S rDNA primers P1/P7 and R16F2n/ R16R2, respectively. PCR amplifications from all infected plants yielded an expected product of 1.8 kb with P1/P7 primers and a 1.2-kb fragment with nested PCR, while no products were evident with DNA from healthy plants. Restriction fragment length polymorphism (RFLP) profiles of the 1.2-kb nested PCR products of two eggplant phyllody phytoplasma and five phytoplasma control strains belonging to different groups used as positive control were generated with the restriction endonucleases RsaI, AluI, Tru9I, T-HB8I, and HpaII. The eggplant phytoplasma DNA yielded patterns similar to alfalfa witches'-broom phytoplasma (GenBank Accession No. AF438413) belonging to subgroup 16SrII-D, which has been recorded in Oman (1). The DNA sequence of the 1.8-kb direct PCR product was deposited in GenBank (Accession No. HQ423156). Sequence homology results using BLAST revealed that the eggplant phyllody phytoplasma shared >99% sequence identity with Scaevola witches'-broom phytoplasma (Accession No. AB257291.1), eggplant phyllody phytoplasma (Accession No. FN257482.1), and alfalfa witches'-broom phytoplasma (Accession No. AY169323). The RFLP and BLAST results of 16S rRNA gene sequences confirm that eggplant phyllody phytoplasma is similar to the alfalfa phytoplasma belonging to subgroup 16SrII-D. To our knowledge, this is the first report of a phytoplasma of the 16SrII-D group causing witches'-broom disease on eggplant in Oman. References: (1) A. J. Khan et al. Phytopathology 92:1038, 2002. (2) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA, 81:8014, 1984.

scholarly journals First Report of Occurrence of Eggplant Wilt Caused by Verticillium dahliae in Korea

Plant Disease ◽  
2000 ◽  
Vol 84 (10) ◽  
pp. 1152-1152
Author(s):  
S. K. Kim ◽  
S. S. Hong ◽  
K. W. Kim ◽  
E. W. Park
Keyword(s):  
Verticillium Dahliae ◽  
Solanum Melongena ◽  
Morphological Characteristics ◽  
Wilt Disease ◽  
Potato Dextrose Agar ◽  
First Report ◽  
Vascular Tissues ◽  
Fungal Isolates ◽  
Pathogenicity Tests ◽  
Root Cutting

A wilt disease occurred on greenhouse-grown eggplants (Solanum melongena L.) at Hanam and Yeojoo, Korea, in 1997. Lower leaves on the 2-month-old wilted eggplants exhibited gradual yellowing, interveinal necrosis, and marginal crinkling and dropped prematurely. Vascular tissues of diseased stems were discolored and turned black. Vertical sections of the stems revealed that the pith had been colonized by the fungus. The disease progressed from lower parts of the plants upward. Incidence of diseased eggplants in greenhouses was 5% on 23 May 1997. Although the incidence increased to 10% on 13 June, it remained constant through early July. Fungal isolates from discolored vascular tissues were initially whitish to cream color on potato-dextrose agar, which turned black due to the formation of microsclerotia. The fungus also produced abundant verticillate conidiophores with phialides and conidia. Based on these cultural and morphological characteristics, the fungus was identified as Verticillium dahliae Klebahn. Pathogenicity tests by root cutting, root dipping, or soil drenching resulted in similar symptoms observed in the naturally infected eggplants. Symptoms were first observed on lower leaves of each eggplant 3 weeks after inoculation. Isolation from symptomatic leaves of the inoculated eggplants yielded V. dahliae. This is the first report of occurrence of Verticillium wilt of eggplant in Korea.

scholarly journals First Report of Ligustrum Virus A on Syringa reticulata var. mandshurica (Oleaceae) with a New Yellow Vein and Malformed Needle-Shaped Leaf Disease in China

Plant Disease ◽  
2018 ◽  
Vol 102 (10) ◽  
pp. 2053 ◽  
Author(s):  
T. Han ◽  
C. X. Yang ◽  
J. J. Fu ◽  
Q. S. Hou ◽  
S. Gang ◽  
...  
Keyword(s):  
Yellow Vein ◽  
First Report ◽  
Leaf Disease

scholarly journals First report of a 'Candidatus Phytoplasma trifolii'-related strain (16SrVI-A) associated with white leaf disease in Spirea japonica

2021 ◽  
Vol 16 (1) ◽  
Author(s):  
Eray Şimşek ◽  
Hümeyra Ayvacı ◽  
Havva Akkurak ◽  
Murat Dikilitas ◽  
Mehmet Ertuğrul Güldür
Keyword(s):  
Related Strain ◽  
First Report ◽  
Leaf Disease ◽  
White Leaf ◽  
White Leaf Disease

scholarly journals First Report of Beech Leaf Disease, Caused by Litylenchus crenatae mccannii, on American Beech (Fagus grandifolia) in Virginia

Plant Disease ◽  
2021 ◽  
Author(s):  
Mihail R. Kantor ◽  
Zafar Ahmad Handoo ◽  
Lynn Carta ◽  
Shiguang Li
Keyword(s):  
North America ◽  
Rhode Island ◽  
Morphological Characteristics ◽  
Pcr Amplification ◽  
Fagus Crenata ◽  
Fagus Grandifolia ◽  
American Beech ◽  
First Report ◽  
Leaf Disease ◽  
Foliar Nematode

Beech leaf disease (BLD) was first reported in 2012 in Lake County, Ohio on American beech trees (Fagus grandifolia Ehrh.). Since then, it spread across the Northeastern United States and has been reported from Ohio, Pennsylvania, New York, New Jersey, Connecticut, Rhode Island, Maine, West Virginia, and Ontario, Canada (Carta et al. 2020; Mara and LaMondia 2020, Reid et al. 2020). The symptoms of BLD are characterized by dark interveinal banding of leaves appearing soon after spring flush that become chlorotic and necrotic through autumn, resulting in canopy thinning in advanced stages, followed in some young trees by death. Litylenchus crenatae mccannii has similar morphological characteristics with Litylenchus crenatae (Kanzaki et al. 2019) reported on Fagus crenata from Japan. However that beech species has not shown BLD symptoms or yielded any L. crenatae mccannii in North America. There are several morphological differences between the two. The North American subspecies have shorter post-uterine sac, narrower body width in mature females, shorter tail in immature females, longer tail in mature females, and longer stylet in males when compared to the Japanese subspecies (Carta et al. 2020). BLD symptoms were found on American beech trees in Prince William Forest Park, Prince William County, Virginia in June, 2021. The affected leaves contained females, males, and juveniles with morphometrics consistent with L. crenatae mccannii (Carta et al. 2020). The crude genomic DNA from a live single Litylenchus was prepared with freeze-thaw lysis (Carta and Li, 2019). The ITS PCR were performed by using the procedures and primer set, ITS-CL-F2 and 28S-CL-R described in the previous study (Carta and Li, 2020). The visualization, the cleanup and the direct DNA sequencing of the PCR products were performed by using the procedures described in the previous studies (Carta and Li, 2018 and 2019). Sequences were submitted to GenBank as accessions MZ611855 and MZ611856. This represents the first report of BLD in Virginia. It is also approximately 300 miles south of the 2020 detection of BLD from New Cumberland, WV, and represents the southernmost detection of the disease and nematode in North America. The author(s) declare no conflict of interest. References Carta, L.K., Li, S. 2018. Improved 18S small subunit rDNA primers for problematic nematode amplification. Journal of Nematology. 50, 533-542. Carta, L.K., Li, S. 2019. PCR amplification of a long rDNA segment with one primer pair in agriculturally important nematodes. Journal of Nematology. 51, e2019-26. Carta, L.K., Li, S. 2020. Improvement of long segment ribosomal PCR amplification for the molecular taxonomic identification of Litylenchus crenatae mccannii in beech trees with beech leaf disease. Journal of Nematology. 52, e2020-016. Kanzaki, N., Ichihara, Y., Aikawa, T., Ekino, T., Masuya, H. 2019. Litylenchus crenatae n. sp. (Tylenchomorpha: Anguinidae), a leaf gall nematode parasitising Fagus crenata Blume Nematology 21 (1), 5-22. http://www.brill.com/nematology doi: 10.1163/15685411-00003190 Marra, R.E., LaMondia, J. 2020. First report of beech leaf disease, caused by the foliar nematode, Litylenchus crenatae mccannii, on American beech (Fagus grandifolia) in Connecticut. Plant Disease (early view). https://doi.org/10.1094/PDIS-02-20-0442-PDN Reed, S. E., Greifenhagen, S., Yu, Q., Hoke A., Burke D. J., Carta L. K., Handoo Z.A., Kantor, M.R., Koch, J. 2020. Foliar nematode, Litylenchus crenatae ssp. mccannii, population dynamics in leaves and buds of beech leaf disease-affected trees in Canada and the US. Forest Pathology 50 (3), e12599.

scholarly journals First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jinjie Hu ◽  
Qian Zhou ◽  
Chaohui Shi ◽  
Yexin Ke ◽  
Shun Xiao ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Solanum Melongena ◽  
Stem Canker ◽  
Morphological Characters ◽  
Single Spore ◽  
Specific Primers ◽  
Fujian Province ◽  
Phomopsis Longicolla ◽  
Fungal Isolation ◽  
First Report

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

scholarly journals First Report of the Association of the 16SrII-D Phytoplasma Subgroup With Little Leaf Disease of Crotalaria in Karnataka, India

Plant Disease ◽  
2016 ◽  
Vol 100 (12) ◽  
pp. 2523-2523 ◽  
Author(s):  
V. Yadav ◽  
V. Thorat ◽  
S. Mahadevakumar ◽  
G. R. Janardhana ◽  
A. Yadav
Keyword(s):  
First Report ◽  
Leaf Disease

scholarly journals First Report of 16SrII-D Phytoplasma Associated with Eggplant Big Bud (Solanum melongena L.) in India

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 517 ◽  
Author(s):  
Vandana Yadav ◽  
S. Mahadevakumar ◽  
G. S. Tejaswini ◽  
N. Shilpa ◽  
M. Y. Sreenivasa ◽  
...  
Keyword(s):  
Solanum Melongena ◽  
First Report

scholarly journals First report of a 'CandidatusPhytoplasma asteris' (16SrI group) associated with little leaf disease ofSolanum melongena(brinjal) in India

2012 ◽  
Vol 26 ◽  
pp. 21 ◽  
Author(s):  
J. Kumar ◽  
S. Gunapati ◽  
S.P. Singh ◽  
A. Lalit ◽  
N.C. Sharma ◽  
...  
Keyword(s):  
First Report ◽  
Leaf Disease

scholarly journals First Report of Bronze Leaf Disease on Hybrid Poplar (Populus × canescens ‘Tower’) Caused by Apioplagiostoma populi in Manitoba, Canada

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1538-1538 ◽  
Author(s):  
P. R. Northover ◽  
M. Desjardins
Keyword(s):  
Apical Cell ◽  
Hybrid Poplar ◽  
Significant Loss ◽  
Golf Course ◽  
Canadian Prairie ◽  
First Report ◽  
Leaf Disease ◽  
Foliar Symptoms ◽  
Causal Fungus ◽  
Voucher Specimens

Poplars (Populus alba × P. tremula (P. × canescens) (Aiton) Smith cv. Tower) are common ornamental and windbreak trees in Manitoba and across the Canadian prairie provinces because of their rapid growth and columnar growth habit. Bronze leaf disease symptoms have been reported on five poplar species (P. alba, P. canescens, P. grandidentata, P. tremula, and P. tremuloides) (2), and the disease presents a significant barrier to the development and continued use of poplars (1). Elimination of tower poplars would represent a significant loss to the Canadian horticultural industry, and the costs incurred in the replacement of existing windbreaks would be high. In August 2002, we observed symptoms of bronze leaf disease on approximately 20-year-old tower poplars, ranging in height from 8 to 12 m at a tree nursery and golf course near Carman, Manitoba (49°30′N, 98°0′W). The leaf laminae of affected plants were chocolate brown, and the petioles and veins were yellow to light green. In the nursery windbreak, 70 trees had foliar symptoms on 30 to 80% of the canopy. At the golf course, eight trees had foliar symptoms on approximately 5 to 20% of the canopy. No fruiting structures were visible on leaf or shoot tissue, and no staining of vascular tissues was observed. Attempts to isolate the causal fungus of bronze leaf disease on artificial media have been unsuccessful (2). In October 2002, branches with symptomatic leaves were covered with netting, and the trapped leaves were left to overwinter. In March 2003, symptomatic leaves were brought to the laboratory and surface sterilized in 1% NaOCl for 1 min, rinsed with sterile water, and incubated at 18°C in moist chambers. After 2 weeks, dark brown, beaked, single perithecia that were 150 to 200 μm long × 150 μm wide emerged from the upper and lower leaf surfaces. Asci were fusoid clavate with a conspicuous apical ring and contained 4 or 6 spores. The two-celled, hyaline ascospores varied from 10.5 to 14.5 × 2 to 3 μm, the basal cell shorter than the apical cell. Leaf symptoms and microscopic fungal features matched those of Apioplagiostoma populi (Cash & A.M. Waterman) Barr, the cause of bronze leaf disease (1,2). Voucher specimens have been deposited in the U.S. National Fungus Collections (BPI 843385). To our knowledge, this is the first report of this fungus in western Canada, and the first confirmed report of this pathogen on tower poplar in Canada. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) J. A. Smith et al. Plant Dis. 86:462, 2002.

Sign in / Sign up

Export Citation Format

Share Document