Evaluating Nutrient Accumulations in Carrot Seed Crop

CSA News ◽  
2021 ◽  
Vol 66 (3) ◽  
pp. 27-27
Keyword(s):  
Seed Crop ◽  
Carrot Seed

scholarly journals Studies on Agronomic Bio-fortification with Micronutrients in Onion (Allium cepa L.) Seed Crop

2019 ◽  
Vol 6 (3) ◽  
pp. 136-139
Author(s):  
Rupali Dogra ◽  
◽  
Ashok K. Thakur ◽  
Uday Sharma ◽  
◽  
...  
Keyword(s):  
Allium Cepa ◽  
Seed Crop ◽  
Allium Cepa L

scholarly journals UAV AND GIS BASED TOOL FOR COLLECTION AND PROPAGATION OF SEEDS MATERIAL – FIRST RESULTS

2016 ◽  
Vol XLI-B8 ◽  
pp. 663-667 ◽  
Author(s):  
K. Stereńczak ◽  
P. Mroczek ◽  
S. Jastrzębowski ◽  
G. Krok ◽  
M. Lisańczuk ◽  
...  
Keyword(s):  
Seed Quality ◽  
The State ◽  
Annual Reports ◽  
Estimation Methods ◽  
Selection Strategy ◽  
Seed Crop ◽  
Forest Reproductive Material ◽  
First Results ◽  
Reproductive Material ◽  
Seed Management

Seed management carried out by The State Forests National Forest Holding is an integral part of rational forest management. Seed collection takes place mainly from stands belonging to first category of forest reproductive material, which is the largest seed base in Poland. In smaller amount, seeds are collected in selective objects of highest forest reproductive material category (selected seed stands, seed orchards). The previous estimation methods of seed crop were based on visual assessment of cones in the stands for their harvest. Following the rules of FRM transfer is additional difficulty of rational seed management which limits the possibility of the use of planting material in Poland. <br><br> Statements concerning forecast of seed crop and monitoring of seed quality is based on annual reports from the State Forest Service. Forest Research Institute is responsible for preparing and publishing above-mentioned statements. A small extent of its automatization and optimization is a large disadvantage of this procedure. In order to make this process more effective web-based GIS application was designed. Its main performance will give a possibility to upload present-day information on seed efficiency, their spatial pattern and availability. Currently this system is under preparation. <br><br> As a result, the project team will get a possibility to increase participation of seed material collected from selected seed base and to share good practices on this issue in more efficient way. In the future this will make it possible to obtain greater genetic gain of selection strategy. <br><br> Additionally, first results presented in literature showed possible use of unmanned aerial system/vehicle (UAS/V) for supporting of seed crop forecast procedure.

scholarly journals Researches on the Main Characteristics of Red Clover Seedlings and their Influence in

2012 ◽  
Vol 69 (1) ◽  
Author(s):  
Marioara GREBENIȘAN ◽  
Doru PAMFIL ◽  
Dorottya Alice DOMOKOS
Keyword(s):  
Plant Breeding ◽  
Seed Production ◽  
Red Clover ◽  
Production Level ◽  
Seed Crop ◽  
Binding Process ◽  
Lower Variability ◽  
Clover Seed ◽  
Number Of Seeds

Concerning the red clover breeding, it is essential to choose as genitors those varieties that possess good characteristics. In order to identify potential genitors, two red clover varieties were studied at Cluj-Napoca: Roxana, diploid variety and Napoca-tetra, tetraploid variety. The analyzed traits comprised the number of capitula/plant, number of seeds/capitulum and the binding process, under the aspect of their contribution to the seed crop and the interaction between those components, in order to provide important clues about di-and tetraploid red clover seed production, for plant breeding. The highest variability (s%=30) presented regarding the number of flowers/capitulum, diploid variety comparatively with a lower variability (s%=26) regarding the number of flowers number/capitulum, tetraploid varieties. Several traits were compared between di-and tetraploid red clover varieties in order to find genitors which can be used for creating new genotypes with high seed production level.

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Sign in / Sign up

Export Citation Format

Share Document