scholarly journals The tobacco phosphatidylethanolamine‐binding protein NtFT4 simultaneously improves vitality, growth and protein yield in human cells

2021 ◽  
Author(s):  
Julia Kronenberg ◽  
Katrin Schrödter ◽  
Gundula A. Noll ◽  
Richard M. Twyman ◽  
Dirk Prüfer ◽  
...  
Keyword(s):  
Binding Protein ◽  
Human Cells ◽  
Protein Yield ◽  
Phosphatidylethanolamine Binding Protein

Increased expression of phosphatidylethanolamine-binding protein 4 (PEBP4) strongly associates with human gliomas grade

2016 ◽  
Vol 127 (2) ◽  
pp. 235-242 ◽  
Author(s):  
Ren-qiang Huang ◽  
Dong-liang Shi ◽  
Wei Huang ◽  
Feng Chen ◽  
Yi-cheng Lu
Keyword(s):  
Binding Protein ◽  
Human Gliomas ◽  
Phosphatidylethanolamine Binding Protein

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Structural and biochemical characterization of Rv2140c, a phosphatidylethanolamine-binding protein fromMycobacterium tuberculosis

FEBS Letters ◽  
2013 ◽  
Vol 587 (18) ◽  
pp. 2936-2942 ◽  
Author(s):  
Georg Eulenburg ◽  
Victoria A. Higman ◽  
Anne Diehl ◽  
Matthias Wilmanns ◽  
Simon J. Holton
Keyword(s):  
Biochemical Characterization ◽  
Binding Protein ◽  
Phosphatidylethanolamine Binding Protein

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Phosphatidylethanolamine-Binding Protein 1 Ameliorates Ischemia-Induced Inflammation and Neuronal Damage in the Rabbit Spinal Cord

Cells ◽  
2019 ◽  
Vol 8 (11) ◽  
pp. 1370 ◽  
Author(s):  
Kim ◽  
Cho ◽  
Jung ◽  
Yoo ◽  
Oh ◽  
...  
Keyword(s):  
Oxidative Stress ◽  
Spinal Cord ◽  
Neuronal Damage ◽  
Binding Protein ◽  
Ischemia Reperfusion ◽  
Spinal Cord Ischemia ◽  
Prostaglandin F2α ◽  
Proteomic Approach ◽  
Phosphatidylethanolamine Binding Protein

In a previous study, we utilized a proteomic approach and found a significant reduction in phosphatidylethanolamine-binding protein 1 (PEBP1) protein level in the spinal cord at 3 h after ischemia. In the present study, we investigated the role of PEBP1 against oxidative stress in NSC34 cells in vitro, and ischemic damage in the rabbit spinal cord in vivo. We generated a PEP-1-PEBP1 fusion protein to facilitate the penetration of blood-brain barrier and intracellular delivery of PEBP1 protein. Treatment with PEP-1-PEBP1 significantly decreased cell death and the induction of oxidative stress in NSC34 cells. Furthermore, administering PEP-1-PEBP1 did not show any significant side effects immediately before and after ischemia/reperfusion. Administration of PEP-PEBP1 improved the Tarlov’s neurological score at 24 and 72 h after ischemia, and significantly improved neuronal survival at 72 h after ischemia based on neuronal nuclei (NeuN) immunohistochemistry, Flouro-Jade B staining, and western blot study for cleaved caspase 3. PEP-1-PEBP1 administration decreased oxidative stress based on malondialdehyde level, advanced oxidation protein products, and 8-iso-prostaglandin F2α in the spinal cord. In addition, inflammation based on myeloperoxidase level, tumor necrosis factor-α level, and high mobility group box 1 level was decreased by PEP-1-PEBP1 treatment at 72 h after ischemia. Thus, PEP-1-PEBP1 treatment, which decreases oxidative stress, inflammatory cytokines, and neuronal death, may be an effective therapeutic strategy for spinal cord ischemia.

Early growth response gene 1, a TRBP binding protein, is involved in miRNA activity of miR-125a-3p in human cells

2015 ◽  
Vol 27 (6) ◽  
pp. 1120-1128
Author(s):  
Junxia Wei ◽  
Yongri Ouyang ◽  
Xia Li ◽  
Baoyi Zhu ◽  
Jie Yang ◽  
...  
Keyword(s):  
Growth Response ◽  
Binding Protein ◽  
Early Growth ◽  
Human Cells ◽  
Response Gene ◽  
Early Growth Response ◽  
Early Growth Response Gene

scholarly journals Incredibly close—A newly identified peroxisome–ER contact site in humans

2017 ◽  
Vol 216 (2) ◽  
pp. 287-289 ◽  
Author(s):  
Maya Schuldiner ◽  
Einat Zalckvar
Keyword(s):  
Endoplasmic Reticulum ◽  
Membrane Protein ◽  
Binding Protein ◽  
Human Cells ◽  
Metabolic Processes ◽  
Contact Site ◽  
Cell Biol ◽  
Associated Proteins

Peroxisomes are tiny organelles that control important and diverse metabolic processes via their interplay with other organelles, including the endoplasmic reticulum (ER). In this issue, Costello et al. (2017. J. Cell Biol. https://doi.org/10.1083/jcb.201607055) and Hua et al. (2017. J. Cell Biol. https://doi.org/10.1083/jcb.201608128) identify a peroxisome–ER contact site in human cells held together by a tethering complex of VAPA/B (vesicle-associated membrane protein–associated proteins A/B) and ACBD5 (acyl Co-A binding protein 5).

Sign in / Sign up

Export Citation Format

Share Document