scholarly journals Impact of aberrant DNA methylation patterns including CYP1B1 methylation in adolescents and young adults with acute lymphocytic leukemia

2013 ◽  
Vol 88 (9) ◽  
pp. 784-789 ◽  
Author(s):  
C.D. DiNardo ◽  
V. Gharibyan ◽  
H. Yang ◽  
Y. Wei ◽  
S. Pierce ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Young Adults ◽  
Acute Lymphocytic Leukemia ◽  
Lymphocytic Leukemia ◽  
Adolescents And Young Adults ◽  
Aberrant Dna Methylation ◽  
Methylation Patterns

scholarly journals Residual DNA methylation at remission is prognostic in adult Philadelphia chromosome–negative acute lymphocytic leukemia

Blood ◽  
2009 ◽  
Vol 113 (9) ◽  
pp. 1892-1898 ◽  
Author(s):  
Hui Yang ◽  
Tapan Kadia ◽  
Lianchun Xiao ◽  
Carlos E. Bueso-Ramos ◽  
Koyu Hoshino ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Acute Lymphocytic Leukemia ◽  
Philadelphia Chromosome ◽  
Hazard Ratio ◽  
Lymphocytic Leukemia ◽  
Aberrant Methylation ◽  
Epigenetic Alterations ◽  
Aberrant Dna Methylation ◽  
Methylation Patterns ◽  
Standard Risk

Pretreatment aberrant DNA methylation patterns are stable at time of relapse in acute lymphocytic leukemia (ALL). We hypothesized that the detection of residual methylation alterations at the time of morphologic remission may predict for worse prognosis. We developed a real-time bisulfite polymerase chain reaction assay and analyzed the methylation levels of p73, p15, and p57KIP2 at the time of initial remission in 199 patients with Philadelphia chromosome-negative and MLL− ALL. Residual p73 methylation was detected in 18 (9.5%) patients, p15 in 33 (17.4%), and p57KIP2 in 7 (3.7%); 140 (74%) patients had methylation of 0 genes and 48 (25%) of more than or equal to 1 gene. In 123 (65%) patients, matched pretreatment samples were also studied and compared with remission ones: in 82 of those with initial aberrant methylation of at least one gene, 59 (72%) had no detectable methylation at remission and 23 (28%) had detectable residual methylation. By multivariate analysis, the presence of residual p73 methylation was associated with a significant shorter duration of first complete remission (hazard ratio = 2.68, P = .003) and overall survival (hazard ratio = 2.69, P = .002). In conclusion, detection of epigenetic alterations allows the identification of patients with ALL with standard risk but with poor prognosis.

Aberrant DNA methylation in pediatric patients with acute lymphocytic leukemia

Cancer ◽  
2003 ◽  
Vol 97 (3) ◽  
pp. 695-702 ◽  
Author(s):  
Guillermo Garcia-Manero ◽  
Sima Jeha ◽  
Jerry Daniel ◽  
Jason Williamson ◽  
Maher Albitar ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Acute Lymphocytic Leukemia ◽  
Pediatric Patients ◽  
Lymphocytic Leukemia ◽  
Aberrant Dna Methylation

Lack of IKZF1 Aberrant DNA Methylation in Acute Lymphocytic Leukemia.

Blood ◽  
2009 ◽  
Vol 114 (22) ◽  
pp. 982-982 ◽  
Author(s):  
Zhihong Fang ◽  
Shaoqing Kuang ◽  
Hui Yang ◽  
Guillermo Garcia-Manero
Keyword(s):  
Dna Methylation ◽  
Cell Lines ◽  
Poor Prognosis ◽  
Acute Lymphocytic Leukemia ◽  
Lymphocytic Leukemia ◽  
Aberrant Methylation ◽  
Gene Promoters ◽  
Start Site ◽  
Pediatric All ◽  
Aberrant Dna Methylation

Abstract Abstract 982 Poster Board I-4 Recently,Mulligan et al have reported on the strong relationship between deletion of IKZF1 and poor prognosis in pediatric acute lymphocytic leukemia (ALL) (NEJM 2009;360:470-80). This study is of significant importance as it may allow for the identification of children with poor prognosis disease not currently identifiable with standard clinical or molecular assays. Aberrant DNA methylation consists on the addition of a methyl group to a cytsosine (C) when it is followed by a guanine (G) in so-called CpG sites. Methylation of CpG rich areas (CpG islands) in the proximity of gene promoters is associated with gene silencing and is considered a functional equivalent to the physical inactivation of genes via deletions or inactivating mutations. Aberrant DNA methylation is very frequent in both adult and pediatric ALL. Indeed, CDKN2A and 2B, two genes known to be frequently methylated in ALL were also found to be deleted in Mullighan's study. Furthermore, CDKN2A has been shown to be both methylated and deleted in patients with hematological malignancies5. Therefore it is possible that aberrant methylation of IKZF1 could provide a functional alternative to its deletion in both adult and pediatric ALL. To study this issue, we analyzed the frequency of IKZF1 methylation in ALL. First using BLAT database (http://genome.brc.mcw.edu/cgi-bin/hgBlat), we established that IKZF1 contains a CpG island in the proximity of its promoter. Subsequently, we designed a set of primers for bisulfite pyrosequencing analysis of IKZF1 methylation (forward primer sequence was GTTATTGTGAAAGAAAGTTGGGAAGAG in positions -116 to -89 from the transcription start site; reverse primer was CCTCCCCCCCAAACTAAAATAC in position +29 to +7 from the start site; and the sequencing primer was AGTTAGTAGGATATTTTAATAAGTG from -78 to -53). Annealing temperature was 59 °C. Conditions for bisulfite conversion of DNA and pyrosequencing have been previously reported. Using these conditions and primers, we first analyzed a battery of 21 leukemia cell lines (Molt4, Jurkat, PEER, T-ALL1, CEM, J-TAG, B-JAB, RS4, ALL1, REH, Raji, Ramos, K562, BV173, HL60, NB4, THP1, U937, OCI-AML3, HEL, KBM5R) of different origins. As negative controls, we used DNA extracted from peripheral blood mononuclear cells from healthy donors and as positive controls SssI treated DNA. None of the cell lines or controls had evidence of DNA methylation of IKZF1 (median 1.53%, range 0.94 to 1.76). By convention, a sample is considered to be methylated if the percent of methylation is above 10 to 15%. Despite the fact that it is extremely unlikely to find DNA methylation in absence of evidence of methylation in cell lines, we decided to analyze the methylation status of IKZF1 in two different cohorts of patients with ALL. The first cohort consisted of a group of pediatric patients (N=20) previously reported by us (Leuk Res 2005;29:881-5). Median methylation was 2.8% (range 1.5 to 11.4). The second cohort of consisted of 17 patients. Median age was 33 years (range 8 to 66); 12 patients (70%) had pre-B/B phenotype, 4 (23%) were female and 14 (82%) had complex cytogenetics. Median methylation was 1.3%, range 0.38 to 2.3%. Our data indicates that functional inactivation of IKZF1 via aberrant DNA methylation is probably a very rare phenomenon in ALL. This data has implications for our understanding of the prognostic role of IZFZ1 in ALL and for future testing of IKZF1 inactivation in this disease. Disclosures: No relevant conflicts of interest to declare.

scholarly journals Aberrant DNA methylation of the Src kinase Hck, but not of Lyn, in Philadelphia chromosome negative acute lymphocytic leukemia

Leukemia ◽  
2007 ◽  
Vol 21 (5) ◽  
pp. 906-911 ◽  
Author(s):  
K Hoshino ◽  
A Quintás-Cardama ◽  
H Yang ◽  
B Sanchez-Gonzalez ◽  
G Garcia-Manero
Keyword(s):  
Dna Methylation ◽  
Acute Lymphocytic Leukemia ◽  
Philadelphia Chromosome ◽  
Src Kinase ◽  
Lymphocytic Leukemia ◽  
Aberrant Dna Methylation

Biology and Treatment of Acute Lymphocytic Leukemia in Adolescents and Young Adults

2013 ◽  
pp. 285-289
Author(s):  
Anjali S. Advani
Keyword(s):  
Young Adults ◽  
Clinical Research ◽  
Patient Population ◽  
Acute Lymphocytic Leukemia ◽  
Optimal Treatment ◽  
Lymphocytic Leukemia ◽  
Adolescents And Young Adults ◽  
Psychosocial Issues ◽  
The Past

The treatment of young adults (16 to 39 years of age) with acute lymphocytic leukemia (ALL) has been a focus of clinical research over the past decade. This review will focus on the biology, optimal treatment, treatment-related toxicities, and psychosocial issues in this patient population.

scholarly journals Age-related disturbances in DNA (hydroxy)methylation in APP/PS1 mice

2018 ◽  
Vol 9 (1) ◽  
pp. 190-202 ◽  
Author(s):  
Leonidas Chouliaras ◽  
Roy Lardenoije ◽  
Gunter Kenis ◽  
Diego Mastroeni ◽  
Patrick R. Hof ◽  
...  
Keyword(s):  
Alzheimer’S Disease ◽  
Dna Methylation ◽  
Brain Aging ◽  
Wild Type ◽  
Dna Hydroxymethylation ◽  
Quantitative Immunohistochemistry ◽  
Age Related ◽  
Aberrant Dna Methylation ◽  
Methylation Patterns ◽  
Age Related Changes

Abstract Brain aging has been associated with aberrant DNA methylation patterns, and changes in the levels of DNA methylation and associated markers have been observed in the brains of Alzheimer’s disease (AD) patients. DNA hydroxymethylation, however, has been sparsely investigated in aging and AD. We have previously reported robust decreases in 5-methylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) in the hippocampus of AD patients compared to non-demented controls. In the present study, we investigated 3- and 9-month-old APPswe/PS1ΔE9 transgenic and wild-type mice for possible age-related alterations in 5-mC and 5-hmC levels in three hippocampal sub-regions using quantitative immunohistochemistry. While age-related increases in levels of both 5-mC and 5-hmC were found in wild-type mice, APPswe/PS1ΔE9 mice showed decreased levels of 5-mC at 9 months of age and no age-related changes in 5-hmC throughout the hippocampus. Altogether, these findings suggest that aberrant amyloid processing impact on the balance between DNA methylation and hydroxymethylation in the hippocampus during aging in mice.

scholarly journals The Impact of Natural Dietary Compounds and Food-Borne Mycotoxins on DNA Methylation and Cancer

Cells ◽  
2020 ◽  
Vol 9 (9) ◽  
pp. 2004 ◽  
Author(s):  
Terisha Ghazi ◽  
Thilona Arumugam ◽  
Ashmika Foolchand ◽  
Anil A. Chuturgoon
Keyword(s):  
Dna Methylation ◽  
Bioactive Compounds ◽  
Epigenetic Modification ◽  
Bioactive Molecules ◽  
Methyl Donors ◽  
Food Borne ◽  
One Carbon Metabolism ◽  
Aberrant Dna Methylation ◽  
Methylation Patterns ◽  
The Impact

Cancer initiation and progression is an accumulation of genetic and epigenetic modifications. DNA methylation is a common epigenetic modification that regulates gene expression, and aberrant DNA methylation patterns are considered a hallmark of cancer. The human diet is a source of micronutrients, bioactive molecules, and mycotoxins that have the ability to alter DNA methylation patterns and are thus a contributing factor for both the prevention and onset of cancer. Micronutrients such as betaine, choline, folate, and methionine serve as cofactors or methyl donors for one-carbon metabolism and other DNA methylation reactions. Dietary bioactive compounds such as curcumin, epigallocatechin-3-gallate, genistein, quercetin, resveratrol, and sulforaphane reactivate essential tumor suppressor genes by reversing aberrant DNA methylation patterns, and therefore, they have shown potential against various cancers. In contrast, fungi-contaminated agricultural foods are a source of potent mycotoxins that induce carcinogenesis. In this review, we summarize the existing literature on dietary micronutrients, bioactive compounds, and food-borne mycotoxins that affect DNA methylation patterns and identify their potential in the onset and treatment of cancer.

Sign in / Sign up

Export Citation Format

Share Document